Dicer (DICER1) (NM_177438) Human Recombinant Protein from OriGene Technologies

Product Details
ItemDicer (DICER1) (NM_177438) Human Recombinant Protein
CompanyOriGene Technologies
PriceSupplier Page
Catalog NumberTP319214
Quantity20 µg
TypeRecombinant Protein
Conjugate/Tag/LabelC-Myc/DDK
Molecule NameDICER1

Add to Compare List

See More Life Science Supplies

OriGene Technologies

9620 Medical Center Drive

# 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only)
Phone: 301-340-3188
Fax: 301-340-9254

Company Profile

Website: www.origene.com/

(1) A virus‐derived microRNA targets immune response genes during SARS‐CoV‐2 infectionEMBO reportsFebruary 3, 2022Meetali Singh et al.MgCl2, 100 mM HEPES pH 7.5). DICER assay was performed using 640 fmols purified human DICER1 (Origene, TP319214) and 1 pmol of precursor RNA in 1× DICER assay buffer at 37°C for 10, 30, and 60 min (MacRae et al,

(2) BCDIN3D regulates tRNAHis 3' fragment processingPLoS geneticsJuly 1, 2019Reinsborough CW, Ipas H, Abell NS, Nottingham RM, Yao J, Devanathan SK, Shelton SB, Lambowitz AM, Xhemalçe B.was incubated with the indicated volumes of human recombinant Dicer (Invitrogen # K3600-01 or Origene TP319214) in a total volume of 15 μl in 100 mM KCl, 10 mM Tris-HCl, pH8, 0.1 mM EDTA, 1 mM MgCl2, 0.5 mM dTT

(3) Structural basis of siRNA recognition by TRBP double-stranded RNA binding domainsThe EMBO journalMarch 15, 2018Masliah G, Maris C, König SL, Yulikov M, Aeschimann F, Malinowska AL, Mabille J, Weiler J, Holla A, Hunziker J, et al.from OriGene Technologies, Inc. 9620 Medical Center Drive, Suite 200 Rockville, MD 20852, Catalog No. TP319214. The nucleotide sequence of shEL86 is 5′‐UUAAUUAUCUAUUCCGUACUUAACCUGACACCUUAAGUACGGAAUAGAUAAUUAAUU‐3′.

Be the First to Write a Review!

Dicer (DICER1) (NM_177438) Human Recombinant Protein from OriGene Technologies

Description

Company Info

OriGene Technologies

Citations (3)

Be the First to Write a Review!