| Description | This plant protein extraction kit can extract soluble plant proteins from fresh, frozen, or dried plant tissues. Suitable for protein extraction from various plants and different parts of plants (such as roots, stems, leaves, flowers, seeds, etc.), with high extraction efficiency, high protein yieldThis plant protein extraction kit can extract soluble plant proteins from fresh, frozen, or dried plant tissues. Suitable for protein extraction from various plants and different parts of plants (such as roots, stems, leaves, flowers, seeds, etc.), with high extraction efficiency, high protein yield, high activity, and fast speed. The extracted protein can be directly subjected to protein electrophoresis analysis, immunoprecipitation, Western Blot, protein activity determination, and protein purification experiments. The concentration of the extracted protein can be determined using the BCA protein quantification kit. P665757Component100 TStorageP665757APlant Protein Extraction Reagent100 mLRTP665757BProtease Inhibitor Cocktail (100×)1 mL-20℃. Avoid freeze/thaw cycle. Precautions：1. This product contains 1mM EDTA.2. To prevent protein degradation, all operations should be carried out on ice as much as possible.3. After extracting protein using this product, the BCA method can be used for protein quantification.4. To achieve the best experimental results, please adjust the optimal usage amount according to the experiment.Operation steps:1. Please remove the required Plant Protein Extraction Agent for pre cooling before protein extraction.2. Weigh the weight of the experimental plant tissue. Add 5 ml of Plant Protein Extraction Agent to 1 g of tissue (add Protein Inhibitor Cocktail in a 1:99 ratio before protein extraction).Attention:1) Before homogenization, cut large pieces of plant tissue into small pieces and homogenize them with a mechanical homogenizer for 10 seconds, with an interval of 10 seconds. Repeat the process three times and select the appropriate homogenization method according to the different tissue samples.2) The amount of lysate used is adjusted according to different parts of the plant. If concentrated protein extracts are needed, the amount of Plant Protein Extraction Agent used can be appropriately reduced.3. After homogenization, incubate on ice for 20-30 minutes.4.4 ℃ 13400 × g, centrifuge for 20 minutes.5. Collect soluble proteins from the supernatant for further purification or downstream analysis... Read More | Product Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 andProduct Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 and α1-4 fucosyl linkages in these substrates without the need to remove sialic acid moieties.For removing core fucose linked α-(1-6) to the core GlcNAc of a GlcNAc-GlcNAc disaccharide structure we recommend our Alpha-(1-6) Fucosidase.• Non-sialidase dependant hydrolysis of antennary fucose moieties• Effective on both glycopeptides and free glycans• Highly specific (α1-3,4 fucosylated glycans)• Kit includes enzyme plus reaction buffer.• Sufficient for up to 50 samplesα(1-3,4) Fucosidase is useful for:nbsp;nbsp;Fucose linkage determinationnbsp;nbsp;Deglycosylating glycoproteins with Lewis structuresContentsAlpha-(1-3,4)-Fucosidase – 200 mM citrate buffer pH 6 containing 250 mM NaCl5x Reaction Buffer – 250 mM sodium phosphate pH 6... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire |