| Description | This reagent kit is designed based on the principle that biotin and Streptavidin have a strong affinity. After the primary antibody of rabbit or mouse origin binds to the corresponding target antigen, the biotinylated antibody in this kit • • Rabbit/mouse universal secondary antibody This reagent kit is designed based on the principle that biotin and Streptavidin have a strong affinity. After the primary antibody of rabbit or mouse origin binds to the corresponding target antigen, the biotinylated antibody in this kit • • Rabbit/mouse universal secondary antibody specifically binds to the primary antibody; The biotin labeled on the secondary antibody binds to streptavidin labeled with peroxidase (HRP), forming an antigen-specific primary antibody biotinylated secondary antibody streptavidin complex labeled with HRP. HRP can catalyze substrate colorimetry, thereby inferring the presence and distribution of the tested antigen. The biotinylated secondary antibody and SA-HRP used in this reagent kit all adopt optimized labeling and purification techniques, which make their staining more sensitive and have a lower background. They are suitable for detecting formalin fixed paraffin embedded tissue sections, as well as frozen sections, cell slides, freshly prepared blood smears, etc. The rabbit/mouse universal Streptavidin HRP kit is suitable for use with aladdin ready to use or concentrated antibodies. Composition:Note: This reagent kit is only suitable for IHC experiments where the primary antibody is an immune or mouse derived antibodNotes:1. Add 1 drop (approximately 50) to each slice µ l) Calculation: 3ml can make 60 slices, and 18ml can make 360 slices.2.For tissues with abundant endogenous biotin content, it is best to use endogenous biotin blockers for blocking when using this kit.3. DAB working solution is prepared and used immediately, and the prepared working solution is effective within 1 hour in the dark at 2-8 ° C.4. During the experiment, avoid drying the tissue slices, so the amount of working fluid used during each incubation step must be sufficient to ensure complete coverage of the tissue sample, and incubation should be carried out in a wet box as much as possible.5. To obtain the best experimental results, please make sure to optimize the experimental conditions and reagent dosage.6. DAB is a suspected carcinogen, please take necessary protective measures when using it. 7. This product is only for scientific research and cannot be used for human reactions or treatments.Operation steps:1. Routine processing of samples such as paraffin or frozen tissue sections or cell slides to be tested.1) Preparation for staining of tissue sections or cell slides: a. Dewaxing and hydration of paraffin sections: bake at 60 º C for 1 hour, dewaxing twice with xylene for 5 minutes each time; Then immerse in gradient ethanol (anhydrous ethanol anhydrous ethanol 95% 85% 75% ethanol) and distilled water for 5 minutes each for hydration. b. Frozen sections and cell climbing sections (or climbing sections) were soaked in 0.01 M pH 7.4 PBS and washed 3 times for 5 minutes. Then cover the tissue (or cells) with 0.1% Triton X-100 and infiltrate for 15 minutes. Wash twice with 0.01 M pH 7.4 PBS for 5 minutes.2) Antigen repair of paraffin sections: In most cases, high-pressure repair with citric acid buffer is suitable for paraffin tissue sections. Preparation of repair solution: Add 10 ml of citric acid buffer (IHC antigen repair solution, 100 x) to 1 L of deionized water, and mix well. Repair process: The repair solution is added to a high-pressure cooker, and the repaired slices are immersed in the repair solution (must have no tissue). Cover the pressure cooker cover, heat until evenly sprayed with steam, and start timing from the spraying. After 1-2 minutes, the pressure cooker leaves the heat source and cools naturally to room temperature. Remove the slices, rinse with distilled water, and rinse twice with PBS (0.01 M pH 7.4) for 3 minutes each time.2. Add an appropriate amount of Solution A white solution, which is an endogenous peroxidase blocking solution, and incubate at room temperature for 10 minutes, then rinse thoroughly with PBS.3. Add an appropriate amount of Solution B white solution dropwise, which is sealed with normal sheep serum working solution. Incubate at room temperature for 10 minutes and shake dry.4. Add an appropriate amount of primary antibody working solution (commercial ready to use antibodies or concentrated antibodies diluted in appropriate proportions) dropwise, incubate according to experimental requirements, and then rinse thoroughly with PBS.5. Add an appropriate amount of Solution C yellow solution, namely biotin labeled sheep anti rabbit/mouse secondary antibody working solution, incubate at room temperature for 10 minutes, and rinse thoroughly with PBS.6. Add an appropriate amount of Solution D red solution, which is HRP labeled streptavidin. Incubate at room temperature for 10 minutes and rinse thoroughly with PBS.7. Preparation of DAB color working solution: According to the required amount, mix DAB-A and DAB-B in a volume ratio of 1:19 to obtain DAB color working solution. Alternatively, one drop (approximately 50) can be added per milliliter of reagent B µ l) Reagent A, mix well.8. Color development: Add an appropriate amount of DAB color development working solution to the tissue section or cell slide that needs to be developed, and the color development time is generally 1-5 minutes. Observe and control the color development time under a microscope. When the optimal color development effect is achieved, rinse with tap water to terminate the color development. The colored slices are re stained, dehydrated and transparent, and can be stored for a long time after sealing... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665730Component24 T96 TStorageN665730ATPS V50 144 µL576 µL-20℃. Avoid freeze/thaw cycle.N665730B5×FA Reaction Buffer144 µL576 µL-20℃. Avoid freeze/thaw cycle.N665730C2×HiFidelity PCR Mix600 µL2×1.2 mL-20℃. Avoid freeze/thaw Products contentN665730Component24 T96 TStorageN665730ATPS V50 144 µL576 µL-20℃. Avoid freeze/thaw cycle.N665730B5×FA Reaction Buffer144 µL576 µL-20℃. Avoid freeze/thaw cycle.N665730C2×HiFidelity PCR Mix600 µL2×1.2 mL-20℃. Avoid freeze/thaw cycle.N665730DPPM48 µL192 µL-20℃. Avoid freeze/thaw cycle.* This kit is suitable for human genomic DNA library construction with a starting template DNA input of 50 ng. We also have transposase library construction kits for human genomic DNA starting at 5 ng and 1 ng, so it is recommended to use different kits for different starting amounts of DNA in order to obtain higher quality libraries. Products IntroductionThis kit is developed for Illumina's high-throughput sequencing platform and provides the enzyme premix system and reaction buffer for genomic DNA library construction, including all components except PCR primers. Compared with the traditional library construction kits, this kit adopts the new transposase method for library construction, which can complete DNA fragmentation, end repair and junction reaction in one simple enzymatic reaction, significantly reducing the amount of template, reducing the number of experimental steps, and shortening the time of library construction; it adopts the high-fidelity DNA polymerase for library enrichment, and the preference-free PCR amplification can expand the coverage area of the sequence, which can be used for efficient and effective sequencing. The use of high-fidelity DNA polymerase for library enrichment and preference-free PCR amplification broadens the coverage area of the sequence and enables efficient preparation of DNA libraries for Illumina's second-generation sequencing platform. The kit is suitable for DNA libraries with a starting template of 50 ng, and all reagents in the kit have been subjected to strict quality control and functional validation to maximize the stability and reproducibility of library construction. Product Features ● DNA fragmentation and junction ligation in one step.● Ultra-fidelity amplification minimizes amplification-preferred steps.Provide your own instruments, kits and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use DNA purification and recovery kit by magnetic bead method.3. Library PCR primer kits: transposase method for second-generation sequencing multi-sample primer kits are recommended. 4. Anhydrous ethanol, deionized water (pH between 7.0 and 8.0).5. Reaction tubes: It is recommended to use low adsorption PCR tubes and 1.5 ml centrifuge tubes. Tips: It is recommended to use high quality filter tips to prevent contamination of kits and library samples. Pre-experiment Preparation and Important Notes1. Avoid repeated freezing and thawing of reagents.2. PCR products are easily contaminated due to improper operation, resulting in inaccurate results. It is recommended to isolate the PCR reaction system preparation area from the PCR product purification area, and to use special pipettes to clean the experimental areas at regular intervals.3. Bead purification: the beads should be equilibrated to room temperature before use, all operations on the beads should be carried out at room temperature, 80% ethanol should be dispensed freshly, the beads should be rinsed and dried until the surface is free of liquid reflections and has a frosted appearance, insufficient drying of the beads will cause ethanol residue that will affect the subsequent experiments, and over-drying of the beads will affect the efficiency of DNA recovery.4. The kit is suitable for human genomic DNA library construction, if the DNA sample is a PCR product, it should be ensured that its length>.500 bp, since transposases do not work on DNA ends, it is recommended to extend the PCR product by 50-100 bp at each end of the PCR product to avoid low coverage of the ends for sequencing.Sample PreparationDNA purity requirements: A260/A280 = 1.8-2.0. Sample DNA: dissolve in ultrapure water. DNA Quantification: Too much or too little DNA will affect the quality of the library. It is recommended to use Nano to test the purity of the genomic DNA and then use Qubit to test the concentration of the genome (do not use any absorbance-based assay for template quantification).Schematic diagram of DNA banking processprocedureDNA fragmentation, junction reaction1. Add the following reagents to a 200 µl PCR tube: 2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows:DNA should be purified immediately after the fragmentation reaction has been performed and the transposase is still in a high state of activity.to prevent smaller library fragments due to DNA over-fragmentation. Purification of fragmentation productsWe recommend the use of the Century Magnetic Bead Method DNA Purification and Recovery Kit.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. Add 50 µl of magnetic beads equilibrated to room temperature to the fragmentation product, vortex and shake for 5 seconds, then let stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant solution until the solution is clear (approximately 3-5 minutes), carefully aspirate the supernatant and discard, avoiding contact with the beads that have bound the target DNA. Note: Do not discard the beads.4. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the centrifuge tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.5. Repeat step 4.6. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, then add 23 µlddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.7. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer 21 µl of supernatant to a new 200 µl PCR tube.PCR amplification Add the following reagents to the 200 µl PCR tube: Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows:Selective recovery of library DNA fragmentsIt is recommended to use CombiVision Magnetic Beads DNA Purification and Recovery Kit for selective recovery of DNA fragments. When different sizes of DNA fragments are required, the amount of magnetic beads to be used is different, please refer to the attached table for the specific amount of magnetic beads to be used (if other brands of magnetic beads are used, you need to find out the optimal amount of magnetic beads to be used on your own).Note: Amplification products can also be fragment length sorted and purified using the Gum Recovery Kit. If there is no special requirement for library length distribution, the amplification products can also be purified without selective recovery of DNA fragments as described on page 6 of the manual.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. Transfer the PCR product to a 1.5 ml centrifuge tube, rehydrate to 100 µl and add several volumes of magnetic beads equilibrated to room temperature, vortex for 5 seconds and let stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, and carefully aspirate the supernatant and transfer it to a new 1.5 ml centrifuge tube.Note: Do not discard the top clear.4. Add several volumes of magnetic beads to the supernatant, vortex and shake for 5 seconds, then let stand at room temperature for 5 minutes.5. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA.Note: Do not discard the beads.6. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.7. Repeat step 6 once.8. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 20 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.9. Remove the centrifuge tube from the magnetic rack, vortex and oscillate to completely resuspend the beads, and let stand at room temperature for 5 minutes. Leave brieflycentrifuge, place the tube on a magnetic rack until the solution is clear, and transfer the supernatant solution to a new centrifuge tube. Table: Suggested amount of magnetic beads for different segment selection recoveryLibrary DNA fragment purificationWe recommend the use of the Century Magnetic Bead Method DNA Purification and Recovery Kit.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. 50 µl of magnetic beads equilibrated to room temperature were added to the PCR product, vortexed and shaken for 5 seconds, and then left to stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant solution until the solution is clear (approximately 3-5 minutes), carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA. Note: Do not discard the beads.4. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the centrifuge tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.5. Repeat step 4.6. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 25 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.7. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube.Library quality controlDetermination of library concentrationIn order to obtain high-quality sequencing results, accurate quantification of DNA libraries is required, and the first recommendation is to use Real-timePCR methods are used for absolute quantification of DNA libraries. Additionally, fluorescent dye methods such as the Qubit method or the fluorescent dye picogreen method can be used; do not use quantification methods based on absorbance measurements here. The following approximate formula can be used to convert the molar concentration of the DNA library. Average total length of librariesApproximate conversion formula Library fragment distributionThe prepared DNA libraries can be detected by agarose gel electrophoresis or Agilent 2100 Bioanalyzer.Range of segment length distributions... Read More | Products contentN665737Component24 T96 TStorageN665737ATPS V50 168 µL672 µL-20℃. Avoid freeze/thaw cycle.N665737B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665737CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665737D2×Products contentN665737Component24 T96 TStorageN665737ATPS V50 168 µL672 µL-20℃. Avoid freeze/thaw cycle.N665737B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665737CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665737D2×PCR Mix600 µL2×1.2 mL-20℃. Avoid freeze/thaw cycle. * This kit is suitable for human genomic DNA library construction, the starting template DNA input is 5 ng. We also have transposase library construction kits for 50 ng and 1 ng of human genomic DNA starting, in order to get a higher quality library, it is recommended to use different kits for different starting amount of DNA. Products IntroductionThis kit is developed for Illumina's high-throughput sequencing platform and provides the enzyme premix system and reaction buffer for genomic DNA library construction, including all components except PCR primers. Compared with the traditional library construction kits, this kit adopts the new transposase method for library construction, which can complete DNA fragmentation, end repair and junction reaction in one simple enzymatic reaction, significantly reducing the amount of template, reducing the number of experimental steps, and shortening the time of library construction; it adopts the high-fidelity DNA polymerase for library enrichment, and the preference-free PCR amplification can expand the coverage area of the sequence, which can be used for efficient and effective sequencing. The use of high-fidelity DNA polymerase for library enrichment and preference-free PCR amplification broadens the coverage area of the sequence and enables efficient preparation of DNA libraries for Illumina's second-generation sequencing platform. The kit is suitable for use with a starting template DNA input of 5 ng, and all reagents in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. Product Features● DNA fragmentation and junction ligation in one step.● Ultra-fidelity amplification minimizes amplification preference.Provide your own instruments, kits and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use DNA purification and recovery kit by magnetic bead method.3. Library PCR primer kit: It is recommended to use transposase method for second generation sequencing multi-sample primer kit.4. Anhydrous ethanol, deionized water (pH between 7.0 and 8.0).5. Reaction tubes: It is recommended to use low adsorption PCR tubes and 1.5 ml centrifuge tubes. Tips: It is recommended to use high quality filter tips to prevent contamination of kits and library samples. Pre-experiment Preparation and Important Notes1. Avoid repeated freezing and thawing of reagents.2. PCR products are easily contaminated due to improper operation, resulting in inaccurate results. It is recommended to isolate the PCR reaction system preparation area from the PCR product purification area, and to use special pipettes to clean the experimental areas at regular intervals.3. Bead purification: the beads should be equilibrated to room temperature before use, all operations on the beads should be carried out at room temperature, 80% ethanol should be dispensed freshly, the beads should be rinsed and dried until the surface is free of liquid reflections and has a frosted appearance, insufficient drying of the beads will cause ethanol residue that will affect the subsequent experiments, and over-drying of the beads will affect the efficiency of DNA recovery.4. The kit is suitable for human genomic DNA library construction, if the DNA sample is a PCR product, it should be ensured that its length>.500 bp, since transposases do not work on DNA ends, it is recommended to extend the PCR product by 50-100 bp at each end of the PCR product to avoid low coverage of the ends for sequencing. Sample PreparationDNA purity requirements: A260/A280 = 1.8-2.0. Sample DNA: dissolve in ultrapure water. DNA Quantification: Too much or too little DNA will affect the quality of the library. It is recommended to use Nano to test the purity of the genomic DNA and then use Qubit to test the concentration of the genome (do not use any absorbance-based assay for template quantification). Schematic diagram of DNA banking processprocedureDNA fragmentation, junction reaction 1. Add the following reagents to a 200 µl PCR tube: 2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows: inactivation reactionAfter the DNA is fragmented, the enzyme is still in a high active state, so it should be removed from the PCR instrument immediately and terminated by adding the Reaction Termination Buffer, in order to prevent the DNA from being fragmented too much and resulting in smaller library fragments.1. Add 3 µl of TS Buffer to the PCR tube containing the fragmentation product.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Incubate at room temperature for 5 min, or if the room temperature is too low, place the reaction on a PCR instrument at 25°C with the thermal cover closed.1. Add the following reagents to a 200 µl PCR tube.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows Selective recovery of library DNA fragmentsIt is recommended to use CombiVision Magnetic Beads DNA Purification and Recovery Kit for selective recovery of DNA fragments. When different sizes of DNA fragments are required, the amount of magnetic beads used is different, please refer to the attached table for the specific amount of magnetic beads used.(If using other brands of magnetic beads, you need to figure out the optimal amount of magnetic beads by yourself).Note: Amplification products can also be fragment length sorted and purified using the Gum Recovery Kit. If there is no special requirement for library length distribution, amplification products can also be purified directly from DNA fragments without selective recovery of DNA fragments as described on page 4 of the manual.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. Transfer the PCR products to a 1.5 ml centrifuge tube, rehydrate to 100 µl, add several volumes of magnetic beads equilibrated to room temperature, vortex for 5 seconds, and let stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, and carefully aspirate the supernatant and transfer it to a new 1.5 ml centrifuge tube.Note: Do not discard the top clear.4. Add several volumes of magnetic beads to the supernatant, vortex and shake for 5 seconds, then let stand at room temperature for 5 minutes.5. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA.Note: Do not discard the beads.6. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.7. Repeat step 6 once.8. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 20 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.9. Remove the centrifuge tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new centrifuge tube. Table: Suggested amount of magnetic beads for different segment selection recovery Library DNA fragment purificationWe recommend the use of the Century Magnetic Bead Method DNA Purification and Recovery Kit.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. 50 µl of magnetic beads equilibrated to room temperature were added to the PCR product, vortexed and shaken for 5 seconds, and then left to stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant solution until the solution is clear (approximately 3-5 minutes), carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA. Note: Do not discard the beads.4. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the centrifuge tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.5. Repeat step 4.6. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 25 µl of ddH O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.7. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube. Library quality controlDetermination of library concentrationIn order to obtain high-quality sequencing results, accurate quantification of DNA libraries is required, and the first recommendation is to use Real-timePCR methods are used for absolute quantification of DNA libraries. Additionally, fluorescent dye methods such as the Qubit method or the fluorescent dye picogreen method can be used; do not use quantification methods based on absorbance measurements here. The following approximate formula can be used to convert the molar concentration of the DNA library. Library fragment distributionThe prepared DNA libraries can be detected by agarose gel electrophoresis or Agilent 2100 Bioanalyzer.Range of segment length distributions... Read More | Products contentProducts IntroductionThe Single Cell Whole Genome Amplification Kit can be used as a template for whole genome amplification of single cells or micro samples. The total time for single-cell amplification is about 3 hours, and 2-5 µg of genomic DNA, with a size of 200-1500 bp, Products contentProducts IntroductionThe Single Cell Whole Genome Amplification Kit can be used as a template for whole genome amplification of single cells or micro samples. The total time for single-cell amplification is about 3 hours, and 2-5 µg of genomic DNA, with a size of 200-1500 bp, can be obtained after lysis, pre-amplification and amplification. The amplified product can be widely used in second-generation sequencing, large fragment copy number variation analysis, SNP typing, qPCR analysis and gene chip analysis.Bring your own instruments and reagentsPCR instrument Reaction tubes: low adsorption tubes recommended Gun Heads: High quality filtered gun heads are recommended Microcentrifuge, vortex mixercaveat The sensitivity of this product is very high, the experimental operation should be completed in a positive pressure ultra-clean bench or clean environment, the concentration of the amplification reaction products is high, should be well isolated to avoid aerosol contamination caused by amplification products.Operation flow diagramprocedurePre-experiment preparationSingle cells were obtained by flow cytometry sorting, buffer dilution, micromanipulation and laser microdissection. It is recommended that the cells be washed prior to the experiments with a 1× PBS solution free of Mg2+ and Ca2+, taking care to ensure that the volume of PBS solution in subsequent experiments does not exceed 2 µl. take note of Since the whole experiment is carried out in the same PCR tube and the reaction volume is small, the pipette tip should not touch the liquid in the tube when adding liquid, so as to avoid taking single cells or DNA out of the reaction system; when pipetting, please add the liquid along the wall of the tube carefully and do not blow the liquid in the PCR tube; before the reaction, please centrifuge briefly to make sure that the liquid in the reaction system is mixed evenly. Thaw the cell lysate, pre-amplifier and amplifier on ice before use.cell lysis 1)Mix Cell Lysis Buffer and Cell Lysis Enzyme according to the number of reactions N, shake to mix, centrifuge briefly and set aside.2)Mix single cells with the cell lysis mix in a PCR tube and run the following program.2. Pre-amplification reaction1)Mix Cell Lysis Buffer and Cell Lysis Enzyme according to the number of reactions N, shake to mix, centrifuge briefly and set aside.2)Add 5 µl of pre-amplification mix to 10 µl of lysis reaction product from the previous step and run the following program. 3. Amplification reaction1)Mix Amplification Buffer and Amp Enzyme Mix according to the number of reactions N, mix with shaking, centrifuge briefly and set aside.2)Add 60 µl of amplification mix to 15 µl of pre-amplification reaction product from the previous step and run the following program.Note: The number of cycles can be adjusted as needed, 14 cycles are recommended for single cells obtained by flow sorting, etc.Amplification product detection 1. Agarose gel electrophoresis 5 µl of the amplified product was subjected to agarose gel electrophoresis (1% agarose gel, 110 V, 25-35 min), and the amplified product was 200-1500 bp in size. 2. Quantitative Amplification products were subjected to magnetic bead or column purification, and purified products were quantified using Qubit with a final yield of 2-5 µg... Read More |