| Description | Product content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligationProduct content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligation of DNA sticky or flush ends in 5 minutes at room temperature (25°C). The kit contains Quick T4 DNA Ligase and 2×Quick Ligation Reaction Buffer optimized for fast and efficient DNA ligation.The ligation efficiency of Quick Ligation is equivalent to 1 hour of conventional ligation with T4 DNA Ligase. The Quick Ligation products can be used directly in routine bacterial transformation experiments.matters needing attention1. This kit enables most of the linkage reactions to reach the reaction endpoint within 5 minutes or less at 25°C. Increasing the reaction time will not enhance the reaction efficiency. If you use the rapid connection reaction after 1 hour, the conversion efficiency will be significantly reduced; if the rapid connection reaction at 25 ℃ overnight, the conversion efficiency will drop to 75%.2. 2×Quick Ligation Reaction Buffer contains ATP, which should be thawed on ice and mixed thoroughly before use. It is recommended to freeze the buffer in small tubes for the first time, so as to avoid repeated freezing and thawing, which will affect the efficiency of DNA ligation.3. Since T4 DNA Ligase contains glycerol, which is sticky and easy to hang on the wall, it is recommended to collect the liquid to the bottom of the tube by centrifugation for a short period of time before use, and the tip of the lance should not go too deep into the liquid surface when taking samples to avoid sticking to the tip of the lance and causing losses.4. If the quick ligation product is used for electrotransformation, the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation, and it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation.Usage1. The reaction solution was prepared according to the following system:*The amount of Insert DNA used: the molar ratio of Vector DNA and Insert DNA is generally 1:3-1:8, and the appropriate molar ratio of Vector DNA and Insert DNA can be selected according to the experimental situation.Calculation of DNA molar number: DNA molar number (nmol)=DNA mass (ng)/( 660daltons x number of inserted DNA bases bp).2. mix gently and centrifuge briefly. react at 25°C for 5 minutes.Note: The reaction time should not exceed 15 minutes, otherwise the connection efficiency will be reduced.3. Do not perform heat inactivation reactions. Centrifuge instantly and collect the solution from the wall to the bottom of the tube.Note: Heat inactivation significantly reduces transformation efficiency due to the presence of PEG in the buffer.4. After the reaction, store the DNA ligation product at 0-4℃, and then carry out transformation experiments; you can also store the DNA ligation product at -20℃.Note: When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.5. Heat shock the ligation product to transform 50 µl of receptor cells or take 1-2 µl of ligation product to electroshock transform 50 µl of receptor cells.Note: 1) When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.(2) If the quick ligation product is used for electrotransformation, it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation because the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation... Read More | Product IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized stateProduct IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized state, it appears purple-blue and non-fluorescent, while in the reduced state, it turns into a reduction product with pink or red fluorescence, with an absorption peak of 530-560nm and an emission peak of 590nm.In the process of cell proliferation, the ratios of NADPH/NADP, FADH/FAD, FMNH/FMN and NADH/NAD in the cell increase and are in a reducing environment. The dye taken into the cell is reduced by these metabolic intermediates and cytochromes and then released outside the cell and dissolved in the culture medium, changing the culture medium from non-fluorescent indigo blue to fluorescent pink. Finally, use an ordinary spectrophotometer or fluorophotometer for detection, and the absorbance and fluorescence intensity are proportional to the number of active cells.Instructions1. Add 10µl of detection reagent to 100µl of cell suspension, and incubate in a cell incubator for 2-6 hours. The color of the medium changes from indigo blue to pink and you can proceed to the next step.2. It is recommended to use a fluorescence microplate reader for detection, the excitation light wavelength is between 530-560 nm, the emission light wavelength is 590 nm, and the relative fluorescence unit (RFU) is recorded.3. Draw a standard curve or cell growth curve: the ordinate (Y axis) is the relative fluorescence unit (RFU); the abscissa (X axis) is the cell number or time point or drug concentration.Precautions1. The appropriate density of cells can increase the detection sensitivity. For 96-well plates, we recommend seeding 100 microliters of cells per well. The cell concentration range is: 100-10,000/well for adherent cells, 2,000-50,000/well for suspension cells, and medium as a blank control. For 384-well plates, the cell concentration and seeding volume are both halved.2. The whole process should be aseptic operation, because microbial contaminants can also reduce the detection reagents and affect the experimental results.3. Pay attention to the concentration of inoculated cells and the incubation time after adding detection reagents. If the cell concentration is too high or the incubation time is too long, it will cause a secondary reduction reaction, resulting in colorlessness and disappearance of fluorescence.4. When incubating, avoid light.5. This product can use fluorescence or spectrophotometric detection, but the sensitivity of fluorescence is high, and the experimental error is small. Fluorescence detection is recommended... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionMetathesis: Ruthenium-Based Metathesis CatalystsRuthenium metathesis catalysts kit I consists of 9 samples of Grubbs 1st and 2nd generation catalysts. These catalysts have applications in ring-closing and ring-opening metathesis, cross-metathesis, ring-opening metathesis polymerization (DescriptionMetathesis: Ruthenium-Based Metathesis CatalystsRuthenium metathesis catalysts kit I consists of 9 samples of Grubbs 1st and 2nd generation catalysts. These catalysts have applications in ring-closing and ring-opening metathesis, cross-metathesis, ring-opening metathesis polymerization (ROMP) and enyne metathesis.Metathesis: Ruthenium-Based Metathesis Catalysts... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export |