| Description | DescriptionTakasago (R)-Ru Cymene Kit I comprises of ruthenium-based biphenyl phosphine cymene catalysts containing either BINAP and SEGPHOS®ligands. These highly reactive and selective catalysts are useful in a variety of asymmetric reactions, mainly asymmetric hydrogenation | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionWhite LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatableDescriptionWhite LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatable milliamp selection for photon intensity (sold seperately)0-30 mA variable LED outputNon-magnetic LED baseChemically resistant LED coverPTFE coated cablingPhoto Kitalysis Starter Kitrequired for operation (sold separately). Best when used withKitAlysis Benchtop Inertion Box(sold separately)... Read More | Cell viability and cytotoxicity assays are usually used for drug screening and compound cytotoxicity testing. The CCK-8 kit uses highly water-soluble tetrazolium salt ( called WST-8 ) to produce water-soluble WST-8 for cell proliferation and cytotoxicity assays. Unlike MTT, WST-8 and WST-8 have no Cell viability and cytotoxicity assays are usually used for drug screening and compound cytotoxicity testing. The CCK-8 kit uses highly water-soluble tetrazolium salt ( called WST-8 ) to produce water-soluble WST-8 for cell proliferation and cytotoxicity assays. Unlike MTT, WST-8 and WST-8 have no cytotoxicity in cell culture medium, so multiple downstream experiments can be performed using the same detection plate. CCK-8 method is a convenient colorimetric method for the determination of cell viability. It does not need the solubilization process and only needs the least steps to provide the results. The CCK-8 method can be used for the determination of 96-well microplates and high-throughput screening of 384-well microplates. Advantage:At present, the commercially available liquid CCK-8 kits generally have defects such as harsh storage conditions ( -4C or -20 ), unstable use in different pH ranges, and easy deterioration ( discoloration or precipitation ). The solid instant CCK-8 kit adopts a new formula and Swiss process, which overcomes these shortcomings of the liquid CCK-8 kit. It can be stored at room temperature for a long time ( > 3 years ), ready to use, stable in a wide pH range, and the experimental results are more reliable. Compared with the liquid CCK-8 kit, the solid-soluble CCK-8 kit has higher sensitivity and the biological response time is shortened by half.Application scope:It can be used for drug screening, cell proliferation assay, cytotoxicity assay, tumor drug sensitivity test and activity detection of biological factors. Operating instructions:This reagent kit can be used for drug screening, cell proliferation assay, cytotoxicity assay, tumor drug sensitivity assay, and activity detection of biological factors.1. Carefully and slowly tear along the gap in the packaging bag;2. Pour all the powder in the bag into a clean container containing 10mL of ultrapure water, shake continuously for 1 minute, and use it when the solid is completely dissolved;3. Unused reagents must be stored at low temperatures below 4 ℃.Equipment required for testing:Enzyme reader 96 well plate with 450-490 nm filter;Carbon dioxide incubator;96 well plate, sterilized transparent plate for cell detection;Multi channel pipette (8 or 12 channels: 10-100 µ l);Blood cell counter or cell counter.Cell viability testing:1. Inoculate cell suspension (100 µ l/well) into a 96 well plate and pre culture the plate in a carbon dioxide incubator for 24 hours (37 ℃, 5% CO2);2. Add 10 µ l of CCK-8 solution to each well (be careful not to generate bubbles in the well as it may affect the reading of OD value);3. Incubate the culture plate in the incubator for 1-4 hours;4. Measure the absorbance at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader;5. If the OD value is not determined temporarily, 10 µ l of 0.1M HCI solution or 1% w/v SDS solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature. Within 24 hours of measurement, the absorbance will not change.Cell proliferation toxicity testing:1. Inoculate cell suspension (100 µ l/well) into a 96 well plate and pre culture the plate in an incubator for 24 hours (37 ℃, 5% CO2);2. Add 10ul of different concentrations of the substance to be tested to the culture plate;3. Incubate the culture plate in the incubator for an appropriate period of time (e.g. 6, 12, 24, or 48 hours);4. Add 10 µ l of CCK-8 solution to each well (be careful not to generate bubbles in the well as they may affect the reading of the OD value);5. Incubate the culture plate in the incubator for 1-4 hours;6. Measure the absorbance at 450nm using an enzyme-linked immunosorbent assay (ELISA) reader;7. If the OD value is not determined temporarily, 10 µ l of 0.1M HCI solution or 1% w/v SDS solution can be added to each well, and the culture plate can be covered and stored in the dark at room temperature. Within 24 hours of measurement, the absorbance will not change.Calculation method for cell survival rate/inhibition rate:Cell survival rate=[As Ab)/(Ac Ab)] x 100%Inhibition rate=[(Ac As)/(Ac Ab)] x 100%As: absorbance of experimental wells (including cells, culture medium, CCK-8 solution, and drug solution);Ac: absorbance of control wells (including cells, culture medium, CCK-8 solution, without drugs);Ab: Blank well absorbance (including culture medium and CCK-8 solution, excluding cells and drugs).Points for attention: 1.Unused reagents must be stored at low temperature below 4 °C, and stored in the dark at-20 °C for two years after unpacking, so as to avoid repeated thawing ; 2.The culture time of CCK-8 is generally 1-4 hours, but the naked eye can be taken out to observe the color degree in about 30 minutes. According to the cell type, the conditions need to be explored. The best reaction time of CCK-8 is based on the best time of specific color development.3. It is recommended to do a few holes to explore the number of inoculated cells and the culture time after adding CCK-8 reagent ; 3.The WST-8 in this kit will react with reducing agents ( such as some antioxidants ) to interfere with the detection. Before the cell proliferation-toxicity test, the background OD can be checked to confirm whether there is a reducing agent in the substance to be tested. If the effect of reducing agent needs to be removed, the fresh medium can be replaced before adding CCK-8 ( remove the medium, wash the cells twice with the medium, and then add the new medium ) ; 4.Phenol red in the medium does not affect the experimental results, and the absorbance of phenol red can be eliminated by deducting the absorbance of the background in the blank hole during calculation, so it will not affect the detection. 5.It is recommended to use a multi-channel pipette to reduce the difference between parallel holes. When adding CCK-8 reagent, it is recommended to add it obliquely to the wall of the culture plate, not to insert it under the liquid surface of the medium, which is easy to produce bubbles and interfere with OD determination. 6.If the drug contains metal, it has an effect on the color of CCK-8. The final concentration of 1mM lead chloride, ferric chloride and copper sulfate will inhibit the color reaction of 5 %, 15 % and 90 %, and reduce the sensitivity. If the final concentration is 10mM, the color reaction will be 100 % inhibited ; 7.When using a 96-well plate for detection, if the cell culture time is long, attention should be paid to the evaporation problem. On the one hand, because a circle around the 96-well plate is the easiest to evaporate, the method of discarding the surrounding circle can be adopted, and the same amount of PBS, water or culture medium can be added. On the other hand, the 96-well plate can be placed near the water source in the incubator to alleviate evaporation ; 8.When using standard 96-well plates, the minimum inoculation amount of adherent cells is at least 1,000 cells / well ( 100µl medium ). The sensitivity of detecting white blood cells is relatively low, so it is recommended that the inoculation amount should not be less than 2,500 cells / well ( 100 µl medium ). If you want to use a 24-well plate or a 6-well plate experiment, first calculate the corresponding inoculation amount per well, and add the CCK-8 solution according to 10 % of the total volume of the medium per well ; 9.Cell culture time varies according to the type and number of cells ( per well ), usually the color of white blood cells is weak, requiring a longer culture time ( 4 hours ) and a large number of cells ( ~ 105 cells / well ) ; 10.CCK-8 reagent is very low toxic to cells. The continuous reaction between it and dehydrogenase in living cells makes the color of the solution deepen and the OD value increase. The following methods can terminate the CCK-8 reaction ( 96-well plate ) : a ) After the color reaction, the culture plate was placed in a refrigerator at 4 ° C ; b ) 10µL 0.1MHCL solution was added to each well ; c ) 10 µL 1 % ( w / v ) SDS ( sodium dodecyl sulfate ) solution was added to each well. After the reaction stopped, the OD value should be measured within 24 hours. 11.To determine the specific number of cells, it is recommended to do the standard curve at the same time... Read More | Inquire |