| Description | This kit is used to extract and purify high-quality total RNA from various plants, and is also suitable for the extraction of fungal hyphal RNA. A unique Shredder separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while silica based membrane is This kit is used to extract and purify high-quality total RNA from various plants, and is also suitable for the extraction of fungal hyphal RNA. A unique Shredder separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while silica based membrane is used to adsorb RNA for purification, effectively removing various pollutants such as polysaccharides through washing. The washed RNA can be directly used in various downstream experiments. RNA with a molecular weight greater than 200 bases was extracted using this reagent kit, with high purity and almost no DNA residue. If it is an RNA experiment that is very sensitive to trace amounts of DNA, the remaining DNA can be digested and removed on a column using DNase I without RNase. The extracted RNA can be used for experiments such as Northern Blot, Dot Blot, RT-PCR, and in vitro translation. R665489Component50 TStorageR665489ABuffer RL35 mLRTR665489BBuffer RLC35 mLRTR665489CBuffer RW140 mLRTR665489DBuffer RW2 (concentrate)11 mLRTR665489ERNase-Free Water10 mLRTR665489FSpin Columns FL with Collection Tubes50 setsRTR665489GSpin Columns RM with Collection Tubes50 setsRTR665489HRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents:β- Mercaptoethanol, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experiment:To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of RNA extraction.3. Please add Buffer RL before use β- Mercaptoethanol, with a final concentration of 1%. Add 10 to 1 ml Buffer RL µ L β Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month. No need to add buffer RLC when using it β- Mercaptoethanol.Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. If precipitation occurs in Buffer RL and Buffer RLC, please heat them to dissolve and place them at room temperature.6. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.7. If downstream experiments are highly sensitive to DNA, it is recommended to treat RNA with DNase I without RNase.Operation steps:1. Take 50-100 mg of fresh plant tissue, add liquid nitrogen and quickly grind it into powder.2. Collect the ground powder into a centrifuge tube (provided by oneself) and add 600 µ L Buffer RL (check if it is added before use) β- Sulfhydryl ethanol or Buffer RLC, vortex oscillation causes it to fully decompose.Attention:1) The main component of Buffer RL is guanidine isothiocyanate, which is suitable for the lysis of most plant tissues. However, in some plant tissues (such as corn endosperm), due to the unique secondary metabolites, guanidine isothiocyanate causes precipitation in the sample, resulting in poor RNA extraction efficiency. In this case, Buffer RLC can be added instead of Buffer RL.2) Incubating at 56 ℃ for 1-3 minutes helps with tissue lysis, but plants with high starch content should not be subjected to high-temperature incubation.3. Transfer all the liquid obtained in step 2 to the spin columns FL that have been loaded into the collection tube, centrifuge at 12000 rpm (~13400 × g) for 2 minutes, and transfer the supernatant from the collection tube to a new centrifuge tube (provided by oneself).Attention:1) When aspirating liquid, the tip of the gun can be cut off for easy sampling.2) Spin Columns FL can remove most of the fragments, but there will still be a small amount flowing out. After centrifugation, precipitation will form in the collection tube. When proceeding to the next step, be careful not to absorb the sediment.4. Add 0.5 times the volume of anhydrous ethanol to the clean cracking solution obtained in step 3 and quickly mix well. Attention: Adding ethanol may cause precipitation, but it does not affect subsequent experiments.5. Add all the solutions obtained in step 4 to the spin columns RM that have been loaded into the collection tube. If it is not possible to add all the solutions to the adsorption column at once, please transfer them in two separate steps. Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add 700 to the adsorption column µ Centrifuge at 12000 rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube. Optional steps: If conducting RNA experiments that are highly sensitive to trace amounts of DNA, replace step 6 with the following steps.1) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.2) Preparation of DNase I mixture: Take 52 µ Add 8 RNase Free Water to it µ 10 x Reaction Buffer and 20 µ DNase I (1 U/ µ l) Mix well and prepare to a final volume of 80 µ The reaction solution of L.Attention:The above system is configured according to our company's DNase I reaction system. Please refer to the corresponding instructions for other company products.3) Add 80 µ l of DNase I reaction solution directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.4) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.7. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.8. Repeat step 7.Centrifuge at 9.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly dry the anhydrous ethanol in the column.Attention:The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column in a new RNase free centrifuge tube, and add 30-50 to the middle of the adsorption column in the air µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 10 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 10... Read More | CFDASE cell proliferation and tracking detection kit is a kit for cell proliferation and tracking detection based on CFDA se. This kit is composed of CFDASE powder, solvent and staining buffer. CFDASE is a derivative of fluorescein diacetate (FDA), which has cell membrane permeability and CFDASE cell proliferation and tracking detection kit is a kit for cell proliferation and tracking detection based on CFDA se. This kit is composed of CFDASE powder, solvent and staining buffer. CFDASE is a derivative of fluorescein diacetate (FDA), which has cell membrane permeability and does not have fluorescence luminescence. When CFDASE penetrates the cell membrane into living cells, it can be catalysed by esterases in the cytosol to produce carboxyfluorescein succinimidyl ester (CFSE), which can emit strong green fluorescence, cannot penetrate the cell membrane, and can remain intact in the cell. CFSE can also spontaneously and irreversibly covalently bind to intracellular amino groups to couple to cellular proteins. Meanwhile, the excess and uncoupled CFDASE returned to the extracellular medium by passive diffusion and was cleared by subsequent washing steps. The fluorescence of non dividing cells labeled by CFDASE is very stable, and the stable labeling time can reach several months, so it is very suitable for cell community analysis. The fluorescence of CFDASE labeled cells is very homogeneous, which is superior to other cell tracking fluorescent probes used previously, such as PKH26, and the fluorescence distribution of the divided progeny cells is also very uniform. In the process of cell division and proliferation, CFSE labeled fluorescence can be evenly distributed to the two progeny cells, and the fluorescence intensity becomes half of the parental cells. According to the fluorescence intensity, flow cytometer (FL1 channel) can detect undivided cells, cells that divide once (1 / 2 of the fluorescence intensity), twice (1 / 4 of the fluorescence intensity), three times (1 / 8 of the fluorescence intensity), and cells that divide more times. CFDASE can detect up to eight or more cleavages. CFDASE labeled cells can be used for proliferation studies in vitro and in vivo, and have the function of not staining adjacent cells. CFDASE is most commonly used to detect the proliferation of lymphocytes, and can also be used to detect the proliferation of fibroblasts, NK cells and other cells. CFDASE labeled cells showed green fluorescence. In addition to flow cytometry to detect cell proliferation, fluorescence microscopy can also be used for homogeneous staining of cell tracking observation.Components:ComponentsC598182-20TC598182-500TA. CFDA SE1 tube1 tubex5B.CFDA SE solvent20 µL500 µLC.10x CFDA SE Buffer1 mL x250 mLMatters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. CFDA and Se are easily hydrolyzed and will deteriorate quickly in aqueous solution. Please avoid contact with water during use. Contact with water during the process of labeling cells is within the permitted range. 3. CFDA se solvent will solidify at lower temperatures such as 4 º C and ice bath and stick to the bottom, wall or cover of the centrifugal tube. It can be used after incubating in a 20-25 º C water bath for a while until it is completely dissolved. 4. this kit optimizes the CFDA se staining system, but users are advised to explore the optimal working concentration and staining time according to their own cell type, culture conditions and application direction. Different cells have different lactonase activities, so the staining effect is different. 5. fluorescent dyes have quenching problems. Please avoid light during operation to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves.Usage method:1. Preparation of reagents(1) Preparation of CFDA SE storage solution: Take one tube of CFDA SE provided in the reagent kit and restore it to room temperature. Instantly centrifuge to allow the powder to fully settle to the bottom of the tube. Add 100 µ L CFDA SE solvent (add 20 µ L CFDA SE solvent) to it and dissolve it thoroughly to prepare CFDA SE storage solution (1000 ×). Prepared CFDA SE storage solution, stored at -20 ℃ in the dark, with a shelf life of two months- Storing at 70 ℃ in the dark can extend the usage time appropriately.(2) Preparation of CFDA SE Buffer: Dilute 10 x CFDA SE Buffer to 1 x with sterile cell culture grade water as needed. The prepared 1 × CFDA SE Buffer can be stored at 4 ℃ and can be stored at -20 ℃ if not in use for a long time.2. Marking and detection(1) Centrifuge the collected cells, use 1 mL 1 × CFDA SE Buffer to re suspend the cells in a 15 mL centrifuge tube, and adjust the cell concentration to 1-5 × 106 cells/mL.(2) Preparation of CFDA SE working solution: Dilute the CFDA SE storage solution (1000 ×) with 1 × CFDA SE Buffer to 2 ×.(3) Staining: Add 1 mL of CFDA SE working solution (2 x) to 1 mL of cell suspension to be labeled, invert and mix well, and incubate at 37 ℃ for 10 minutes.(4) Immediately add 5 times the volume of preheated complete culture medium (including serum) to the centrifuge tube, invert and mix well to terminate the labeling reaction.(5) Centrifuge at 1000 rpm for 5 minutes at room temperature to remove the supernatant, then wash once with 5-10 mL of complete culture medium.(6) Add 5-10 mL of complete culture medium and incubate at 37 ℃ for 5 minutes to promote the residence of CFDA SE in the cells and the entry of unreacted CFDA SE into the complete cell culture medium. Centrifuge at 1000 rpm for 5 minutes at room temperature to remove the supernatant and complete the final wash.(7) Subsequently, the cells can be cultured using the normal cultivation method. The labeling effect can be directly observed under a fluorescence microscope, or cell proliferation can be detected by flow cytometry after appropriate cultivation time, showing green fluorescence. The labeled cells can also be used for transplantation in live animals and for fluorescence tracing.Note: a If cell fixation is required, use aldehyde fixatives such as 4% paraformaldehyde to fix at room temperature for 15 minutes; If additional labeling such as antibody labeling is required afterwards, please permeabilize the cells with ice acetone for 10 minutes. b. The optimal labeling concentration and incubation time for CFDA SE vary for different cells. The initial experiment can be conducted according to the experimental steps. If the effect is not satisfactory, it is recommended to adjust the staining concentration and incubation time to achieve the best labeling effect.Scope of application：Cell proliferation assay... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN669983Component240 TStorageN669983AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/thaw cycle.N669983BIndex N973-N996 Primers for Illumina24×10 µL-20℃. Avoid freeze/thaw cycle. Products IntroductionThis kit is a companion kit to the transposase-Products contentN669983Component240 TStorageN669983AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/thaw cycle.N669983BIndex N973-N996 Primers for Illumina24×10 µL-20℃. Avoid freeze/thaw cycle. Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More | Product introduction：This kit uses an improved SDS alkaline lysis method combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of rapid purification of plasmid DNA. It is suitable for extracting up to 500ug of high-purity plasmid DNA from 120-300ml bacterial Product introduction：This kit uses an improved SDS alkaline lysis method combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of rapid purification of plasmid DNA. It is suitable for extracting up to 500ug of high-purity plasmid DNA from 120-300ml bacterial culture for sequencing, in vitro transcription and translation, restriction enzyme digestion, bacterial transformation and other molecular biology experiments.Scope of application：Nucleic acid extraction and purification... Read More |