Assay kits are used to carry out analyses in a broad scope of applications including the study of targets such as drugs, molecules, disease pathways, chemical elements or compounds, and organisms. They are a routine procedure in the modern pharmaceutical, medical and forensic world as well as research and university laboratories around the globe. Assay kits come with all the necessary reagents, instructions and protocols for fast and efficient processing, allowing for repeatable results.
|  |  |  |  |  |
| Company | Aladdin Scientific Corporation | Aladdin Scientific Corporation | Aladdin Scientific Corporation | Aladdin Scientific Corporation | Aladdin Scientific Corporation |
| Item | Human Genomic DNA Quantification Kit | CETP RP Activity Assay | Ionotropic Agonists Kit | NGS Barcode Adapters 1-16 Kit for Ion Torrent | NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) |
| Catalog Number | H665940 | C462916 | I275853 | N670210 | N666055 |
| Price | Supplier Page | Supplier Page | Supplier Page | Supplier Page | Supplier Page |
| Description | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | DescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences theDescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences the reverse cholesterol transport pathway.Preparation instructionsSuitable for high-throughput screening (HTS), mechanism of action (MOA) studies, and structure-activity relationship (SAR) work in CETP sources.PrincipleThe CETP RP Activity Assay uses a proprietary substrate that enables the detection of CETP-mediated neutral lipid mass transfer. The method is useful for measuring CETP activity in recombinant protein (RP) or purified CETP samples and has a high D... Read More | Store at -20°C. Please refer to protocols | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |
| Get Quote | Supplier Page | Supplier Page | Supplier Page | Supplier Page | Supplier Page |