| Description | EndoFree Plasmid Midi Kit Cat No. Component Size（50T） Storage E665631A Buffer P1 30 mL RT E665631B Buffer P2 30 mL RT E665631C Buffer E3 30 mL RT E665631D Buffer PS 15 mL RT E665631E Buffer PW (concentrate) 10 mL RT E665631F Endo-free Buffer EB 10 mL RTEndoFree Plasmid Midi Kit Cat No. Component Size（50T） Storage E665631A Buffer P1 30 mL RT E665631B Buffer P2 30 mL RT E665631C Buffer E3 30 mL RT E665631D Buffer PS 15 mL RT E665631E Buffer PW (concentrate) 10 mL RT E665631F Endo-free Buffer EB 10 mL RT E665631G RNase A (10 mg/mL) 600 µL RT E665631H Buffer ER 8 mL RT E665631I CWBlue 300 µL RT E665631J Spin Columns DL with Collection Tubes 50 EA RT E665631K Endo-Remover FM with Collection 50 EA RTProduct Introduction:Endotoxins are a common pollutant in plasmid extraction. Due to the high sensitivity of eukaryotic cells to endotoxins, the presence of endotoxins in plasmids can greatly reduce the transfection efficiency of eukaryotic cells. This reagent kit provides a simple, fast, and efficient new method for extracting endotoxin free plasmids. The extracted plasmids can remove endotoxins to the maximum extent possible and effectively remove contamination of genomic DNA, RNA, proteins, and other substances. This reagent kit is suitable for extracting 5-15mL of bacterial solution. On the basis of alkaline lysis of cells, it efficiently and specifically binds plasmid DNA through a new silicon-based membrane. Each adsorption column can adsorb up to 100 µ The plasmid DNA of g is effectively removed using a special buffer system and endotoxin removal filter column, effectively removing impurities such as endotoxins and proteins. The plasmid obtained from this kit has high purity and stable quality, making it particularly suitable for cell transfection. It can also be used for downstream experiments such as DNA sequencing, PCR, PCR based mutations, in vitro transcription, transformed bacteria, and endonuclease digestion.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment:1. All components can be stably stored in a dry, room temperature (15-30 ℃) environment for 1 year, and can be stored at 2-8 ℃ for longer periods of time. Buffer P1 with RNase A added can be stably stored at 2-8 ℃ for 6 months.2. Before the first use, add all RNase A solution to Buffer P1, mix well, and store at 2-8 ℃. Before use, let it sit at room temperature for a period of time. After returning to room temperature, use.3.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer P2 and Buffer E3. If there is any crystallization or precipitation, you can take a water bath at 37 ℃ for a few minutes to restore clarity.5. Be careful not to come into direct contact with Buffer P2 and Buffer E3, and immediately cover them tightly after use.6.The amount and purity of plasmid extraction are related to factors such as bacterial culture concentration, strain type, plasmid size, and plasmid copy number.Operation steps:1. Take 5-15 mL of overnight cultured bacterial solution and add it to a centrifuge tube (self provided). Centrifuge at 13000 rpm (~16200 × g) for 1 minute to collect bacteria, and try to discard all the supernatant as much as possible.2. Add 500 to the centrifuge tube containing bacterial sediment µ L Buffer P1 (please check if RNase A has been added first), mix thoroughly with a pipette or vortex oscillator, and suspend bacterial precipitation. Attention: If the bacterial blocks are not thoroughly mixed, it will affect the cracking effect, resulting in low extraction amount and purity.3. Add 500 to the centrifuge tube µ L Buffer P2, gently invert and mix 8-10 times, allowing the bacterial cells to fully lyse. Leave at room temperature for 3-5 minutes. At this point, the solution should become clear and viscous. Attention: Mix gently and do not shake vigorously to avoid interrupting genomic DNA and mixing genomic DNA fragments in the extracted plasmid. If the solution does not become clear, it indicates that the bacterial count may be too high and the lysis may not be complete. The bacterial count should be reduced.4. Add 500 to the centrifuge tube µ L Buffer E3, immediately invert and mix 8-10 times until white flocculent precipitates appear. Let it stand at room temperature for 5 minutes. Centrifuge at 13000 rpm for 5 minutes, extract the supernatant, and add it to the filter column (Endo Remove FM) (already loaded into the collection tube). Centrifuge at 13000 rpm for 1 minute to filter, then transfer the filtrate from the collection tube to the centrifuge tube (self provided). Attention: 1) After adding Buffer E3, it should be immediately mixed to avoid local precipitation. 2) The maximum volume of the adsorption column is 750 µ L. So please filter the supernatant twice and mix it in the same self provided centrifuge tube.5. Add 450 to the filtrate µ Mix L isopropanol upside down.6. Column balance: Add 200 to the spin columns DL that have been loaded into the collection tube µ L Buffer PS, centrifuge at 13000 rpm for 2 minutes, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Transfer the mixed solution of filtrate and isopropanol from step 5 to an equilibrium adsorption column (already loaded into a collection tube). 8.13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Attention: The maximum volume of the adsorption column is 750 µ L. So the solution obtained in step 5 is divided multiple times and passed through the column. 9. Add 750 to the adsorption column µ L Buffer PW (please check if anhydrous ethanol has been added first), centrifuge at 13000 rpm for 1 minute, and discard the waste liquid in the collection tube.10. Place the adsorption column back into the recovery manifold and centrifuge at 13000 rpm for 1 minute.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).11. Place the adsorption column in a new centrifuge tube (self provided)... Read More | Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize matrix effects, cross-reactions and unspecific binding in immunoassays like ELISA, Western blotting, Immunohistochemistry, protein arrays and immuno-PCR.The Effect Diluents, Animal-free are used alternatively to the standard sample or antibody dilution buffers: In ELISA for the dilution of specimen and detection antibodies. In Western Blotting for the dilution of primary and secondary antibodies. In Protein arrays for the dilution of specimen and detection antibodies. In immuno-PCR as a washing buffer.Three versions of the diluent are offered: Low, Medium and High for optimal discrimination between specific and unspecific reaction and for minimizing strong interference effects e.g., by RF (rheumatoid factors), HAMAs (human-a-mouse Abs) or by endogenous components that bind and mask the analyte.Composition & Properties The Effect Diluents, Animal free contain no animal components and are free of phosphates.Working Procedure 1.Mix thoroughly prior to use. 2.Dilution recommendations a.Dilute antibodies according to the instruction of the antibody b.Dilution of the specimen is recommended at 1:2 or higherTips & TricksEffect Diluents must not be considered as blocking buffers. Recommended blocking buffers are: Synthetic Blocking Buffer, ELISA (cat. no. S494401), Synthetic Blocking Buffer, Blotting (cat. no. S494457) and WellChampion (cat. no. W494467) for plate blocking and stabilization (preparation of pre-coated plates). Complex sample matrices, such as serum and plasma, may contain interfering factors that affect the ability of the assay to accurately quantify the target analyte. Strong interferences are often caused by RFs and HAMAs. This matrix effect can cause high background in the negative control or false negatives in the sample measurement. To reduce this effect the samples can be diluted in the Effect Diluents, Animalfree.Handling & Storage Store solution 2-8°C or -15 to -30°C (tolerates freezing and thawing cycles)... Read More | DescriptionProvides an inert environment to run oxygen sensitive cross-coupling reactions in a laboratory fume hood.Designed to be used with KitAlysis High-Throughput Screening Kits and KitAlysis 24-Well Reaction Block | This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. Purified lactose antibodies were coated on a microplate to produce solid-phase antibodies. Lactose was added to the microplate of the coated monoclonal antibody, along with HRP labeled lactose antigens, to compete for binding. After thorough washing, the substrate TMB was added for colorimetry. The depth of sample color is negatively correlated with the content of lactose in the sample. Measure the absorbance (OD value) at a wavelength of 450nm using an enzyme-linked immunosorbent assay (ELISA) reader, and calculate the content of lactose in the sample through a standard curve.Kit composition:130times concentrated washing solution20ml×1 bottle8.1Standard S1（80µg/L）0.5ml×1bottle2Enzyme-linked immunosorbent assay6ml×1 bottle8.2Standard S2（40µg/L）0.5ml×1bottle3Enzyme labeling coated plate96 holes x 1 pieces8.3Standard S3（20µg/L）0.5ml×1bottle4Color reagent A solution6ml×1 bottle8.4Standard S4（10µg/L）0.5ml×1bottle5Color developer B solution6ml×1 bottle8.5Standard S5（5µg/L）0.5ml×1bottle6Stop solution6ml×1 bottle9Instructions1 copy7Sample Diluent6ml×1 bottle10Microplate Sealers2 sheetsSpecimen requirements:1. Specimen processing:(1) After collecting the water sample, it is repeatedly freeze-thawed three times at -20 ℃, and then filtered through glass fiber for future reference(2) The tissue samples should be extracted using butanol: methanol: water (5:25:70 V: V: V), or extracted according to relevant literature. The experiment should be conducted as soon as possible after extraction. If the experiment cannot be conducted immediately, the specimen can be stored at -20 ℃ for future reference2. Samples containing NaN3 cannot be detected as NaN3 inhibits the activity of horseradish peroxidase (HRP).Operation steps:1. Sample addition: Set up standard wells, blank wells (blank control wells do not include samples and enzyme-linked immunosorbent assay reagents, the other steps are the same), and sample wells to be tested. Add 50 microliters to the standard well on the enzyme-linked immunosorbent assay (ELISA) plate, and first add 40 diluents to the sample well to be tested µ l. Then add 10 more samples to be tested µ L (The final dilution of the sample is 5 times). Add the sample to the bottom of the enzyme-linked immunosorbent assay (ELISA) plate well, avoiding touching the well wall as much as possible. Gently shake and mix well.2. Enzyme addition: Add 50 enzyme labeled reagents to each well µ l. Excluding blank holes.3. Warm incubation: Seal the plate with a sealing film and incubate at 37 ℃ for 60 minutes.4. Solution preparation: Dilute 30 times the concentrated washing solution with distilled water and set aside for later use5. Washing: Carefully remove the sealing film, discard the liquid, shake dry, fill each well with washing solution, let it stand for 30 seconds, then discard. Repeat this process 5 times and pat dry.6. Color development: Add color development agent A50 to each well first µ l. Add color developer B50 again µ l. Gently shake and mix well, and develop color at 37 ℃ in the dark for 15 minutes7. Termination: Add 50% termination fluid to each hole µ l. Terminate the reaction (at this point, the blue color immediately turns yellow).8. Measurement: Zero the blank hole and sequentially measure the absorbance (OD value) of each hole at a wavelength of 450nm. The measurement should be conducted within 15 minutes after adding the termination solution.Calculation:Draw a standard curve on a coordinate paper with the concentration of the standard substance as the x-axis and the OD value as the y-axis. Based on the OD value of the sample, determine the corresponding concentration from the standard curve; Multiply it by the dilution factor; Alternatively, a linear regression equation can be used to calculate the standard curve using the concentration and OD value of the standard substance. The OD value of the sample can be substituted into the equation to calculate the sample concentration, which is then multiplied by the dilution factor to obtain the actual concentration of the sample.Notes:1. The kit should be balanced at room temperature for 15-30 minutes before use when taken out from the cold storage environment. If the enzyme coated plate is not used up after opening, the Flat noodles should be stored in a sealed bag.2. Concentrated detergent may precipitate crystals. When diluted, it can be heated in a water bath to aid in dissolution. Washing does not affect the results.3. A sampler should be used for each step of sample addition, and its accuracy should be regularly calibrated to avoid experimental errors. It is best to control the sample addition time within 5 minutes. If there are a large number of specimens, it is recommended to use a firing gun for sample addition.4. Please make a standard curve at the same time as each measurement, preferably with a re hole. If the content of the substance to be tested in the sample is too high (the OD value of the sample is greater than the OD value of the first well of the standard well), please dilute the sample diluent by a certain multiple (n times) before measurement. When calculating, please multiply the total dilution multiple (x n x 5).5. The sealing film is only for one-time use to avoid cross contamination.6. Please store the substrate in dark.7. Strictly follow the instructions and determine the test results based on the reading of the enzyme-linked immunosorbent assay (ELISA) reader8. All samples, washing liquids, and various waste should be treated as infectious substances.9. The components of this reagent with different batch numbers shall not be mixed.Detection range:two µ G/L-90 µ G/L... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |