| Description | Q665720 Component 200T Storage Q665720A Buffer L2 25 mL RT Q665720B Buffer N3 80 mL RT Q665720C Buffer PB 35 mL RT Q665720D Buffer PW (concentrate) 25 mL RT Q665720E Buffer EB 30 mL RT Q665720F RNase A (10 mg/mL) 800 渭L RT Q665720G Spin Columns DM with Collection Tubes 200 EA RTProduct Q665720 Component 200T Storage Q665720A Buffer L2 25 mL RT Q665720B Buffer N3 80 mL RT Q665720C Buffer PB 35 mL RT Q665720D Buffer PW (concentrate) 25 mL RT Q665720E Buffer EB 30 mL RT Q665720F RNase A (10 mg/mL) 800 渭L RT Q665720G Spin Columns DM with Collection Tubes 200 EA RTProduct IntroductionThe biggest feature of this kit: simple and fast, high extraction volume. The whole extraction process does not take more than 10 minutes, without centrifugation to collect bacteria and resuspend the bacterium, directly add the unique super lysate Buffer L2 to the cultured bacterial solution, followed by neutralization, centrifugation and passing through the column, and the extracted plasmid can be as high as 30 µg, and maximize the removal of proteins, genomes and other impurities. The extracted plasmid DNA can be directly used for bacterial transformation, digestion, PCR, in vitro transcription, sequencing and other downstream experiments.Self-contained reagent: anhydrous ethanol.Pre-experiment Preparation and Important Notes1. The kit can be stored in a dry, room temperature (15-30°C) environment for 1 year. For longer storage, the centrifuge columns can be placed at 2-8°C.2. Before the first use, add all of the RNase A solution to Buffer N3, mix well, and store at 2-8°C.3. Anhydrous ethanol should be added to Buffer PW before the first use according to the instructions on the reagent bottle label.4. If there is any precipitation in Buffer L2 before use, please put it in a 37℃ water bath and keep mixing until the solution becomes clear before use.Operation steps1. Take 600 µl of bacterial culture into a 1.5 ml centrifuge tube (supplied).2. Add 100 µl of Buffer L2 to the above centrifuge tube and gently turn the solution up and down 8 times; the solution should change from turbid to a clear purple color, indicating complete lysis. The cleavage time should not exceed 2 minutes.3. Add 350 µl of Buffer N3 to the above centrifuge tube (please check that RNaseA has been added first) and immediately mix well by turning up and down about 8-10 times, at which point the solution should turn completely yellow and a yellow precipitate should form. centrifuge at 13,000 rpm for 2-3 minutes.4. Slowly pour the supernatant obtained in step 3 into the prepared adsorption columns (Spin Columns DM with Collection Tubes) to avoid sedimentation into the columns.5. Centrifuge at 13,000 rpm for 15 seconds, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.6. Add 150 µl Buffer PB to the adsorption column and centrifuge at 13,000 rpm for 15 seconds.7. Add 400 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first) and centrifuge at 13,000 rpm for 1 minute.8. Place the adsorbent column in a new centrifuge tube (self-provided), add 30-100 µl Buffer EB to the middle part of the adsorbent membrane, centrifuge at 13,000 rpm for 1 min, collect the plasmid DNA, and store at -20°C for long term storage.When the amount of extracted bacterial liquid is >600µl, the following procedure can be used:1. This kit can extract up to 3ml of bacterial solution, if the amount of extracted bacterial solution is more than 600µl, it is necessary to centrifuge the bacterial solution exceeding 600µl at 13,000rpm for 30 seconds (to collect the bacterial body), discard the supernatant and then add 600µl of bacterial solution, and then resuspend the bacterial body at the bottom of the tube thoroughly and then proceed to the following operation.2. Add 100µl Buffer L2 to the above centrifuge tube, gently invert the solution up and down 10 times, if the solution is not clarified, need to continue to invert the mixing until the solution becomes a clear purple color, the lysis time should not be more than 2 minutes. (If the solution is still turbid, the amount of bacteria is too large, and the amount of bacteria should be reduced appropriately.)3. Add 350 µl of Buffer N3 to the above centrifuge tube (please check that RNaseA has been added first) and immediately mix well by turning up and down until the purple solution turns completely yellow and a yellow precipitate is formed before proceeding to the next step. centrifuge at 13,000 rpm for 5 minutes.4. Transfer the supernatant to a new centrifuge tube, add 200 µl of isopropanol, mix up and down several times, mix well and transfer to the adsorbent column (Spin Columns DM with Collection Tubes), due to the amount of solution is too large, this time, it is necessary to centrifuge the column in two separate times, centrifugation at 13,000 rpm for 15 seconds, pour off the waste liquid in the collection tube, and put the adsorbent column back to the The adsorbent column should be placed back into the collection tube.5. Add 150 µl Buffer PB to the adsorption column and centrifuge at 13,000 rpm for 15 seconds.6. Add 400 µl Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first) and centrifuge at 13,000 rpm for 1 minute.7. Place the adsorbent column in a new centrifuge tube (self-provided), add 50-200 µl Buffer EB to the middle part of the adsorbent membrane, leave it at room temperature for 2 min, centrifuge at 13,000 rpm for 1 min, collect the plasmid DNA, and store it at -20°C for a long time... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionMetathesis: Ruthenium-Based Metathesis CatalystsRuthenium metathesis catalysts kit I consists of 9 samples of Grubbs 1st and 2nd generation catalysts. These catalysts have applications in ring-closing and ring-opening metathesis, cross-metathesis, ring-opening metathesis polymerization (DescriptionMetathesis: Ruthenium-Based Metathesis CatalystsRuthenium metathesis catalysts kit I consists of 9 samples of Grubbs 1st and 2nd generation catalysts. These catalysts have applications in ring-closing and ring-opening metathesis, cross-metathesis, ring-opening metathesis polymerization (ROMP) and enyne metathesis.Metathesis: Ruthenium-Based Metathesis Catalysts... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export |