| Description | Product DescriptionOur Glycan Sequencing Kit includes the enzymes and buffer required to sequence ten N-linked oligosaccharides.ContentsNeuraminidase from Arthrobacter ureafaciens – 80 µlBeta-Galactosidase from Streptococcus pneumoniae – 60 µlN-Acetylglucosaminidase from Product DescriptionOur Glycan Sequencing Kit includes the enzymes and buffer required to sequence ten N-linked oligosaccharides.ContentsNeuraminidase from Arthrobacter ureafaciens – 80 µlBeta-Galactosidase from Streptococcus pneumoniae – 60 µlN-Acetylglucosaminidase from Streptococcus pneumoniae) – 40 µlAlpha-Mannosidase from Jack Bean – 20 µlCore Alpha-Mannosidase from X. manihotis) – 10 µl5X Reaction buffer – 400 µlAnalysisMany methods of analysis are available, including HPLC, gel electrophoresis, HPAEC, capillary electrophoresis, and mass spectrometry. For more information on these methods, please contact us.StabilityThe Glycan Sequencing Kit is stable at least 12 months when stored properly. Several days exposure to ambient temperatures will not reduce activity.PurityAll Enzymes are tested for contaminating protease by incubating 10 µg of denatured BSA with 2 µl of enzyme at 37°C for 24 hours. SDS-PAGE analysis of the treated BSA shows no evidence of degradation.The production host strains for our recombinant enzymes have been extensively tested and do not produce any detectable glycosidases. Enzymes purified from native sources are tested for contaminating exoglycosidases The absence of exoglycosidase contaminants is confirmed by extended incubations with the corresponding pNP-glycosides... Read More | When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occurWhen apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in genomic DNA, a large number of sticky 3'-oh ends will be generated, which can interact with YF under the catalysis of deoxyribonucleotide terminal transferase (TDT) ®/ CY dUTP binding can directly detect apoptotic cells by fluorescence microscopy or flow cytometry. This kind of method is called terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL). Because normal or proliferating cells have almost no DNA breaks, there is no 3'-oh formation and they can rarely be stained. TUNEL method can stain intact single apoptotic nuclei or apoptotic bodies in situ, can accurately reflect the typical biochemical and morphological characteristics of apoptosis, and can detect a very small number of apoptotic cells, so it is widely used in the study of apoptosis. This kit has a wide range of applications and can be used to detect apoptosis in frozen or paraffin sections, as well as cultured adherent cells or suspended cells. It can selectively detect apoptotic cells, but not necrotic cells or cells with DNA strand breaks caused by irradiation and drug treatment. This kit detects cell apoptosis with a short time-consuming, one-step staining reaction and can be detected after washing.Component: Instruction: Experimental materials (self provided)PBS buffer (1 x, pH~7.4). 0.2% Triton X -100 (PBS formulation). 0.1% Triton X -100 (PBS formulation, containing 5 mg/mLBSA)4% paraformaldehyde (prepared with PBS)Immunohistochemical penDewaxing solvent (paraffin section sample)Related reagents for paraffin section processingAnti fluorescence quenching and sealing agent. ddH2Oexperimental design. A. Positive control:Prepare positive control slides using DNaseI treatment. DNaseI can digest single or double stranded DNA and expose the 3 '- OH end, artificially causing cell apoptosis. One experiment per time is sufficient. (To verify if there are any issues with the experimental operation and reagent kit)B. Negative control:Use TUNEL Reaction Buffer without TdT Enzyme and replace TdT Enzyme with ddH2O. (Mainly to exclude non-specific staining caused by cell apoptosis, operational processes, and other reasons; and to adjust the exposure intensity of the shooting.)C. Experimental processing group.The experimental group operated normally according to the instructions.D. Experimental control group.The experimental group operated normally according to the instructions.Experimental steps1. Sample preparation:(1) For adherent cells or cell smearsa. Clean once with PBS.Note: If you are concerned that the cells on the cell smear may not adhere firmly, you can dry the sample to make the cells adhere more firmly.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at 4 ℃ for 30 minutes. Clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Clean twice with PBS.d. Step 2: TUNEL reaction.(2) For suspended cells or cell suspensionsa. Collect cells (3-5 x 106 cells), centrifuge at 1000 rpm for 5 minutes, and wash twice with PBS.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and resuspend the cells thoroughly. Fix at 4 ℃ for 30 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.d. Step 2: TUNEL reaction.(3) Paraffin tissue sectioninga. Dewaxing and hydration: Place the sliced samples sequentially in xylene I (10 min) → xylene II (10 min) → 100% ethanol I (5 min) → 100% ethanol II (5 min) → 95% ethanol (5 min) → 90% ethanol (5 min) → 80% ethanol (5 min) → 70% ethanol (5 min) → ddH2O rinse for 5 min, rinse twice.Note: Xylene is toxic and volatile. Please perform this operation in a fume hood.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(4) Frozen tissue sectionsa. Fixation: Take out frozen sections and warm them back to room temperature. Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at room temperature for 30 minutes. Wash twice with PBS for 10 minutes each time.Note: If you are concerned that formaldehyde cleaning may not be clean enough, it may affect the final dyeing effect. After formaldehyde fixation is completed, an appropriate amount of 2 mg/mL glycine can be added and washed for 10 minutes to neutralize the residual fixing solution, and then PBS cleaning can be carried out.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(5) Positive treatment (only the positive control is subjected to this step, and other samples are directly subjected to the TUNEL reaction step)a. Dilute 10 x DNase I Buffer with ddH2O in a ratio of 1:10 to 1 x DNase I Buffer for later use.b. Drip 100 µ L of 1xDNase I Buffer onto the processed sample, covering all sample areas, and equilibrate at room temperature for 5 minutes.c. Dilute DNase I (2 U) with 1 x DNase I Buffer at a ratio of 1:100/ µ L) A working solution with a final concentration of 20 U/mL.d. Discard the buffer and add 100 µ Incubate DNase I working solution with a concentration of 20 U/mL at room temperature for 10 minutes.e. Discard DNase I working solution and clean twice with PBS.f. Step 2: TUNEL reaction.2. TUNEL reaction(1) Prepare TUNEL reaction solution (ready to use):/1 sample5sample10 sampleTdT enzyme1 µL5 µL10 µLYF®488/555/594/640 TUNEL Reaction Buffer49 µL245 µL490 µLTUNEL Total volume of reaction solution50 µL250 µL500 µL(2) For adherent cells, cell smears, or tissue sectionsa. Add 50 to each sample µ L TUNEL reaction solution, evenly cover the sample with the reaction solution. The appropriate time for dark incubation at 37 ℃ (recommended staining time for cells is 30 minutes to 1 hour, and tissue staining time is 2 hours).Note: 50 µ L TUNEL reaction solution is suitable for smear, slicing, or 96 well plates (other different well plates can adjust the volume of TUNEL reaction solution appropriately to cover cells). If the sample to be tested is a smear, slice, or in a 24 well plate, 12 well plate, or 6 well plate, anti evaporation film can be used, or self sealing bags or other appropriate materials can be used to cut circular plastic sheets slightly smaller than the holes. After adding TUNEL reaction solution dropwise, cover the sample to prevent the evaporation of TUNEL reaction solution and make the TUNEL reaction solution evenly cover the sample.b. Discard the TUNEL reaction solution, wash twice with PBS, and then wash three times with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mL BSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. (Optional) Add an appropriate concentration of 5 to each sample µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes. After staining, discard DAPI staining solution and wash twice with PBS for 5 minutes each time.d. (Optional) Slice sealing: Add 50 drops to each sample µ L anti fluorescence quenching sealing agent (anti fluorescence quenching sealing agent may not be suitable for certain dyes, it is recommended to conduct pre experimental testing for compatibility before the experiment), cover the cover glass, gently tap the cover glass with the blunt end of tweezers to remove bubbles and ensure complete sealing.e. Use filter paper to remove excess liquid and add 100 to the sample area µ Keep the sample moist with PBS and immediately observe under a fluorescence microscope.(3) For suspended cells or cell suspensionsa. Add 50 to each sample tube µ Gently resuspend cells in LTUNEL reaction solution and incubate at 37 ℃ in the dark for 30-1 hour. Gently resuspend cells with a micropipette every 15 minutes.b. Centrifuge at 2000 rpm for 5 minutes, discard TUNEL reaction solution, and wash twice with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mLBSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. Add 100 to each sample tube µ L concentration is 5 µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes.d. Join 400 µ L PBS resuspended cells and immediately detected with a flow cytometer or observed under a fluorescence microscope after smearing.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. when the staining background is heavy or non-specific staining is obvious, the staining time can be appropriately reduced. 3. it is recommended to add negative control and positive control groups during the experiment. 4. please wear mask and gloves when using component A. if it contacts the skin, please wash it with plenty of water immediately. 5. fluorescent dyes have quenching problems. Please try to avoid light to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves.Product parameters:490/515 nm;Scope of application:Late apoptosis detection, TUNEL Kit... Read More | Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '- deoxyuridine) is a pyrimidine analog that integrates into the DNA duplex during DNA synthesis. Edu detection is based on the "click" reaction. A copper catalyzed azide reacts covalently with alkynes to form covalent bonds. In this kit, edu contains alkynes, Aladdin ® 488 / 555/594/647a azide dyes contain azide compounds. The edu labeling proliferation of click method is rapid and effective, and easy to use. BrdU method requires DNA denaturation (such as acid denaturation, thermal denaturation or digestion with DNase) to expose BrdU, so as to facilitate BrdU antibody binding; The edu method only needs paraformaldehyde fixation and Triton X-100 penetration to make the detection reagent enter the cells, and only a small amount of azide dye is needed to label the integrated edu very effectively. This kit contains all components required for edu method detection, and can be used for proliferation detection of cultured cells in vitro.Component:Product parameters:555/565 nm;Instruction: Experimental materials (self provided). 10 mM PBS, pH 7.2-7.6. 4% paraformaldehyde fixing solution (in PBS)Propensive reagent (0.5% Triton X -100 in PBS). 2 mg/mL glycine solution (in ddH2O). 3% BSA in PBS, pH 7.2-7.6. 1% BSA in PBS, pH 7.2-7.6. ddH2O. 96/24/12/6 well culture plate or dishFluorescence microscopy detection method1. Cell cultureTake logarithmic growth stage cells and inoculate them into a 96 well plate with 4 × 103-1 × 105 cells per well (the number and density of cells can be adjusted according to cell size, growth rate, and specific requirements of experimental treatment), and culture until normal growth stage.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU marking(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to the incubation time, and high concentrations, such as 10-50, should be used for short-term incubation (<2 hours) µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash the cells twice with a 3% BSA washing solution after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, remove the culture medium. Wash cells twice with 1X PBS for 5 minutes each time to remove EdU residues that have not been incorporated into DNA. Cells with weak adhesion can reduce cleaning intensity. Join 50 µ After incubating at room temperature for 20 minutes with 4% paraformaldehyde fixative, remove the fixative.(2) Add 50 to each hole µ L 2 mg/mL glycine solution, incubate at room temperature for 5 minutes, and neutralize the remaining fixed solution.(3) At a rate of 100 per hole µ Wash cells twice with 3% BSA.(4) Remove the washing solution and add 100 µ L 0.5% Triton X -100, incubate at room temperature for 10 minutes.5. EdU detectionNote: Each sample in this reference step uses 100 µ The working fluid of L can be adjusted by users according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer (component C): Dilute component C 10 times with ddH2O.(2) Configure 5 x Click iT EdU buffer additives (component E): add 300 µ Mix L of ddH2O into a 30 mg E component tube (final concentration of 100 mg/mL) until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio, and prepared into a 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 1.Table 1 Click it working fluidReaction componentsTaking the sample size of 10 holes as an example1×Click-iT EdU Reaction buffer855 µLCuSO4 (Component D)40 µLYF® 488/555/594/647A Azide(Component B)5 µL1×Click-iT EdU Buffer additives100 µLTotal volume1 mL(5) Remove penetration enhancer, 100 per well µ Wash twice with 3% BSA washing solution of L.(6) Add 100 to each hole µ L Click iT working solution, evenly covering cells.(7) Incubate at room temperature in dark for 30 minutes.(8) Remove Click-iT working fluid and add 100 µ After washing cells twice with 3% BSA, remove the washing solution and add 100 µ L PBS keeps cells moist. If there are no other special requirements, photography analysis can be carried out.6. DNA re staining (optional)(1) Using 100 µ Wash the cells once with PBS and remove the washing solution.(2) Dilute Hoechst 33342 (component F) 2000 times with PBS.(3) Add 100 to each hole µ Incubate L 1 x Hoechst 33342 solution at room temperature in dark for 15-30 minutes.(4) Remove Hoechst 33342 solution and use 100 µ Wash cells twice with PBS.7. Imaging and analysisIt is recommended to take fluorescence microscopy photos immediately after staining is completed for observation; If conditions permit, please store in a dark and moist environment at 4 ° C for 3 days before taking photos. Flow cytometry detection method1. Cell cultureInoculate 1 × 105~3 × 106 cells per well into a 6-well plate.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU labeled cells(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours. The time of EdU incubation of cells can be directly used as an indicator for measuring cell DNA synthesis, and the choice of time point and incubation time depend on the cell growth rate. Pulse labeled cells incubated with brief EdU can be used to study cell cycle dynamics.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to the incubation time, and high concentrations such as 10-50 should be used for short-term incubation (<2 hours) µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash cells twice with 1% BSA after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, collect cells, add 1 mL of PBS to each tube to clean the cells, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant to remove EdU residue that has not been added to DNA.(2) Add 1 mL of 4% paraformaldehyde fixative to each tube to resuspend cells.(3) Incubate at room temperature for 20 minutes, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(4) Add 1 mL of 2 mg/mL glycine to each tube and incubate for 5 minutes. Neutralize the remaining fixed solution, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant. Add 1 mL of PBS to each tube for cleaning once, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(5) Add 1mL of 0.5% Triton X-100 osmotic enhancer to each tube and resuspend cells. Incubate at room temperature for 10 minutes.5. EdU detectionNote: For 6-well plate samples, reference can be made to 1 mL of working solution per well. Users can adjust the dosage according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer: Dilute component C 10 times with ddH2O.(2) Prepare 5 x Click iT EdU buffer additives (component E): Add 300 µ L ddH2O to 30 mg of component E in a test tube (final concentration 100 mg/mL), mix well until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio to form 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive storage solution with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 2.Table 2 Click it working fluidReaction componentsVolume of liquid required for a single reaction1×Click-iT EdU Reaction buffer875 µLCuSO4 (Component D)20 µLYF® 488/555/594/647A Azide(Component B)5 µL1×Click-iT EdU Buffer additives100 µLTotal volume1 mL(5) Soak at 1000 rpm for 5 minutes, discard the supernatant, remove the enhancer, add 1mL of 1% BSA washing solution to each tube and wash twice. Soak at 1000 rpm for 5 minutes, discard the supernatant.(6) Add 1 mL of Click iT working solution to each tube and mix well.(7) Incubate at room temperature in dark for 30 minutes.(8) Soak at 1000 rpm for 5 minutes, discard the staining reaction solution, add 1% BSA to each tube to wash the cells twice, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells again with 1 mL of 1% BSA (the volume of resuspend cells can be adjusted according to the number of cells), and detect with a flow cytometer.Note: If other biomarker tests are required, please refer to step 4.6. Intracellular antigen labeling (optional steps)(1) Add antibody working solution and mix well.(2) Under dark conditions, incubate antibodies at appropriate temperature and time.7. Flow detection and analysis:(1) It is recommended to conduct flow cytometry testing immediately after dyeing is completed; If conditions are limited, please store in a dark place at 4 ℃ for testing, but it should not exceed 3 days.(2) It is recommended to test the number of cells up to one million levels as much as possible. If the number of cells is small, the number of cells tested can be adjusted to 100000 levels starting from the experiment. For cases where the cell yield is too low (just to the level of ten thousand), it may not be conducive to making a flow chart. Therefore, the cleaning frequency in step 5 (8) can be appropriately reduced.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. fluorescent dyes have quenching problems. Please try to avoid light during experimental operation to slow down fluorescence quenching. 3. click it edu buffer additive solution should be prepared and used immediately to ensure the best results. 4. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application:Cell proliferation detection (cell imaging flow universal)... Read More | Product introduction:Product introduction:Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Product introduction:Product introduction:Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) uses RedNucleus I staining to detect cell cycle. RedNucleus I is a far-infrared nucleic acid dye with cell membrane permeability, which can quickly enter living cells, specifically bind to DNA, and perform cell cycle detection on living cells without RNase digestion. Compared with the traditional PI staining method, the cells do not need to be broken or fixed, and the operation is simpler. RedNucleus I is a fluorescent dye of double-stranded DNA, and the fluorescence intensity after binding to double-stranded DNA is proportional to the content of double-stranded DNA. The intracellular DNA content can be measured by flow cytometry, and then the cell cycle analysis can be carried out according to the distribution of DNA content. After RedNucleus I staining, assuming that the fluorescence intensity of G0 / G1 phase cells is 1, the theoretical value of the fluorescence intensity of G2 / M phase cells containing two copies of genomic DNA is 2, and the fluorescence intensity of S phase cells undergoing DNA replication is between 1-2. In addition, RedNucleus I is compatible with dyes such as Horizon BV / BUV, FITC and R-PE, and can be periodically detected after sample staining.The kit is usually used to detect the cell cycle of cultured adherent or suspended cells. If it is used for cell cycle detection of tissues, the tissues must be digested into a single cell state.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. this product is applicable to the detection of living cells and fixed cell cycle with certain limitations. Whether it is applicable to different types of cells needs to be determined after testing. If fixation is needed, it is recommended to use ice bath pre cooling 75-80% ethanol -20 ℃ to fix cells overnight. 3. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Instruction: Experimental materials ( self-provided ):①cell lines or other cell samples ( self-prepared ) ;②This kit ; ③ trypsin ( self-prepared ) ;④ Cell culture medium containing FBS ( self-prepared ) ; Experimental procedure: 1.Preparation of cell samples : ( 1 ) ( This step is for adherent cells, if suspended cells, can be carried out directly step ( 2 ) ) Digest cells with trypsin, add cell culture medium, gently blow away cells, collected into the centrifuge tube. Note : The number of cells on the machine needs to reach 50,000 and above, so the initial number of cells collected needs to be sufficient. ( 2 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. Carefully remove the supernatant, add about 1 mL of ice bath pre-cooled 1 × staining buffer ( 10 × staining buffer diluted with diH2O at 1 : 10 ), re-suspend the cells. Repeat once. ( 3 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. After the supernatant was discarded, 1 mL of culture medium was added to re-suspend the cells ( for fixed cells, 1 × PBS can also be used to re-suspend ). Gently flick the bottom of the centrifuge tube to properly disperse the cells to avoid cell aggregation. 2.Staining : 4 µL of RedNucleus I staining solution was added to each tube of cell samples, slowly and fully mixed, and incubated at room temperature in dark for 20 min ( or incubated at 37 ° C in dark for 5-10 min ). The optimal incubation time of different cells is different, and the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect. 3.Flow cytometry detection and analysis : Excited at 638 nm by flow cytometry, it is recommended to detect in RL3 or FL4 channels, or use RL1 and RL2 channels. Cell DNA content analysis and light scattering analysis were performed using appropriate analysis software.Scope of application:Cell cycle detection... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |