| Description | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionThe 1 µm Coupling Kit makes conducting immunoprecipitation and biomolecule separation easier and more flexible. The Kit contains AnteoBind™activated 1 µm magnetic particles that give you increased antibody binding capacity and functionality, while the included blocking DescriptionThe 1 µm Coupling Kit makes conducting immunoprecipitation and biomolecule separation easier and more flexible. The Kit contains AnteoBind™activated 1 µm magnetic particles that give you increased antibody binding capacity and functionality, while the included blocking buffer decreases background noise. Reduce reagent preparation time; remove traditional surface preparation steps such as EDC and replace these steps with the 1 µm pre-activated magnetic particles provided. This Kit reduces aggregation and gives you the freedom and ability to develop multifunctional particles for diverse applications, including dual labelling.Binding Capacity and Dispersity:Binding Capacity:> 20 µg IgG/mgMonodispersity:> 90% (by light microscopy determination)Particle based immunoassays, bioseparations and immunoprecipitation... Read More | DescriptionRefer to the product′s Certificate of Analysis for more information on a suitable instrument technique. Contact Technical Service for further support | Products contentN665993Component240 TStorageN665993AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665993BIndex N925-N948 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle. Products Introduction This kit is a companion kit to the transposase-Products contentN665993Component240 TStorageN665993AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665993BIndex N925-N948 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle. Products Introduction This kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More | Products content S666097Component200 TStorageS666097A5×SuperFast One Step RT-qPCR U+ Buffer1 mL-20℃. Avoid freeze/thaw cycle.S666097BSuperFast One Step U+ Enzyme200 µL-20℃. Avoid freeze/thaw cycle.S666097CRNase-Free Water2×1.5 mL-20℃. Avoid freeze/thaw cycle. Products content S666097Component200 TStorageS666097A5×SuperFast One Step RT-qPCR U+ Buffer1 mL-20℃. Avoid freeze/thaw cycle.S666097BSuperFast One Step U+ Enzyme200 µL-20℃. Avoid freeze/thaw cycle.S666097CRNase-Free Water2×1.5 mL-20℃. Avoid freeze/thaw cycle. Products IntroductionThe SuperFast Probe One Step RT-qPCR U+ Kit is designed for quantitative PCR assays using RNA as a template (e.g., RNA viruses). Using gene-specific primers (GSP), reverse transcription and qPCR reactions are completed in a single tube, eliminating the need for additional tube-opening/pipetting operations, greatly increasing throughput and reducing the risk of contamination. The dUTP/UNG anti-contamination system is introduced in this kit. The heat-sensitive UNG rapidly degrades U-containing contaminants at room temperature; it is rapidly inactivated by reverse transcription at 55°C, without affecting the efficiency and sensitivity of qRT-PCR. Combined with optimized buffer systems and antibody-modified Taq enzymes and mutated M-MLV, the SuperFast Probe One Step RT-qPCR U+ Kit provides sensitivity up to 0.1 pg of total RNA or <10 copies of RNA template and enhanced thermal stability. 5× SuperFast One Step RT-qPCR U+ Buffer contains the following components The 5× SuperFast One Step RT-qPCR U+ Buffer contains an optimized buffer system and dNTP/dUTP Mix, which is particularly suitable for high specificity, low template concentration and multiplexed rapid detection of fluorescently labeled probes such as TaqMan. caveatBefore use, please mix the product gently by turning it up and down after it is completely melted to avoid foaming, and use it after brief centrifugation. Avoid repeated freezing and thawing of the product.ROX dye is used to correct the fluorescence signal error between the quantitative PCR wells, this product does not contain ROX dye, if you need to match the ROX dye with the instrument you are using, please contact your local business or call CombiSense customer service at 4006-222-360. PCR reaction system Attention: (1) Usually, the final primer concentration of 0.2 µM can get better results, and 0.1-1.0 µM can be used as a reference for setting the range. If the amplification efficiency is not high, the concentration of primer can be increased; if non-specific reaction occurs, the concentration of primer can be decreased to optimize the reaction system.(2) The final concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe to adjust the concentration.3) Because templates from different species contain different numbers of copies of the target gene, the template can be diluted in a gradient to determine the optimal amount of template to usePCR reaction conditionsmovetemptimingcirculatereverse transcription55°C1 min1premutability95°C10s1)1denaturation95°C1 s40-45Annealing/Extension55-60°C2)10-15s3)40-45Attention: (1) The enzyme used in this product is activated under the condition of pre-denaturation at 95℃ for 30s. Under this condition, most of the templates can be well unchained. For templates with high GC content and complex secondary structure, the pre-denaturation time can be extended to 1min, so as to make the starting template fully unchained, and if the high temperature treatment time is too long, it will affect the activity of the enzyme; for simple templates, pre-denaturation time of 1-10s can also be used, and the optimal pre-denaturation time can be determined according to the template situation.(2) It is recommended to use two-step PCR reaction program, the annealing temperature should be 55-60℃ as the reference range, and the annealing temperature can be increased when non-specific reaction occurs. If you can't get good results due to the use of primers with low Tm values or long amplification products, you can try three-step PCR amplification.3) Whether the actual Real Time PCR instrument used supports rapid amplification cycles, please perform a pre-experiment to verify this for the first attempt... Read More |