| Description | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | EndoFree Plasmid Midi Kit Cat No. Component Size（50T） Storage E665631A Buffer P1 30 mL RT E665631B Buffer P2 30 mL RT E665631C Buffer E3 30 mL RT E665631D Buffer PS 15 mL RT E665631E Buffer PW (concentrate) 10 mL RT E665631F Endo-free Buffer EB 10 mL RTEndoFree Plasmid Midi Kit Cat No. Component Size（50T） Storage E665631A Buffer P1 30 mL RT E665631B Buffer P2 30 mL RT E665631C Buffer E3 30 mL RT E665631D Buffer PS 15 mL RT E665631E Buffer PW (concentrate) 10 mL RT E665631F Endo-free Buffer EB 10 mL RT E665631G RNase A (10 mg/mL) 600 µL RT E665631H Buffer ER 8 mL RT E665631I CWBlue 300 µL RT E665631J Spin Columns DL with Collection Tubes 50 EA RT E665631K Endo-Remover FM with Collection 50 EA RTProduct Introduction:Endotoxins are a common pollutant in plasmid extraction. Due to the high sensitivity of eukaryotic cells to endotoxins, the presence of endotoxins in plasmids can greatly reduce the transfection efficiency of eukaryotic cells. This reagent kit provides a simple, fast, and efficient new method for extracting endotoxin free plasmids. The extracted plasmids can remove endotoxins to the maximum extent possible and effectively remove contamination of genomic DNA, RNA, proteins, and other substances. This reagent kit is suitable for extracting 5-15mL of bacterial solution. On the basis of alkaline lysis of cells, it efficiently and specifically binds plasmid DNA through a new silicon-based membrane. Each adsorption column can adsorb up to 100 µ The plasmid DNA of g is effectively removed using a special buffer system and endotoxin removal filter column, effectively removing impurities such as endotoxins and proteins. The plasmid obtained from this kit has high purity and stable quality, making it particularly suitable for cell transfection. It can also be used for downstream experiments such as DNA sequencing, PCR, PCR based mutations, in vitro transcription, transformed bacteria, and endonuclease digestion.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment:1. All components can be stably stored in a dry, room temperature (15-30 ℃) environment for 1 year, and can be stored at 2-8 ℃ for longer periods of time. Buffer P1 with RNase A added can be stably stored at 2-8 ℃ for 6 months.2. Before the first use, add all RNase A solution to Buffer P1, mix well, and store at 2-8 ℃. Before use, let it sit at room temperature for a period of time. After returning to room temperature, use.3.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer P2 and Buffer E3. If there is any crystallization or precipitation, you can take a water bath at 37 ℃ for a few minutes to restore clarity.5. Be careful not to come into direct contact with Buffer P2 and Buffer E3, and immediately cover them tightly after use.6.The amount and purity of plasmid extraction are related to factors such as bacterial culture concentration, strain type, plasmid size, and plasmid copy number.Operation steps:1. Take 5-15 mL of overnight cultured bacterial solution and add it to a centrifuge tube (self provided). Centrifuge at 13000 rpm (~16200 × g) for 1 minute to collect bacteria, and try to discard all the supernatant as much as possible.2. Add 500 to the centrifuge tube containing bacterial sediment µ L Buffer P1 (please check if RNase A has been added first), mix thoroughly with a pipette or vortex oscillator, and suspend bacterial precipitation. Attention: If the bacterial blocks are not thoroughly mixed, it will affect the cracking effect, resulting in low extraction amount and purity.3. Add 500 to the centrifuge tube µ L Buffer P2, gently invert and mix 8-10 times, allowing the bacterial cells to fully lyse. Leave at room temperature for 3-5 minutes. At this point, the solution should become clear and viscous. Attention: Mix gently and do not shake vigorously to avoid interrupting genomic DNA and mixing genomic DNA fragments in the extracted plasmid. If the solution does not become clear, it indicates that the bacterial count may be too high and the lysis may not be complete. The bacterial count should be reduced.4. Add 500 to the centrifuge tube µ L Buffer E3, immediately invert and mix 8-10 times until white flocculent precipitates appear. Let it stand at room temperature for 5 minutes. Centrifuge at 13000 rpm for 5 minutes, extract the supernatant, and add it to the filter column (Endo Remove FM) (already loaded into the collection tube). Centrifuge at 13000 rpm for 1 minute to filter, then transfer the filtrate from the collection tube to the centrifuge tube (self provided). Attention: 1) After adding Buffer E3, it should be immediately mixed to avoid local precipitation. 2) The maximum volume of the adsorption column is 750 µ L. So please filter the supernatant twice and mix it in the same self provided centrifuge tube.5. Add 450 to the filtrate µ Mix L isopropanol upside down.6. Column balance: Add 200 to the spin columns DL that have been loaded into the collection tube µ L Buffer PS, centrifuge at 13000 rpm for 2 minutes, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Transfer the mixed solution of filtrate and isopropanol from step 5 to an equilibrium adsorption column (already loaded into a collection tube). 8.13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Attention: The maximum volume of the adsorption column is 750 µ L. So the solution obtained in step 5 is divided multiple times and passed through the column. 9. Add 750 to the adsorption column µ L Buffer PW (please check if anhydrous ethanol has been added first), centrifuge at 13000 rpm for 1 minute, and discard the waste liquid in the collection tube.10. Place the adsorption column back into the recovery manifold and centrifuge at 13000 rpm for 1 minute.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).11. Place the adsorption column in a new centrifuge tube (self provided)... Read More | Inquire | DescriptionWhite LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatableDescriptionWhite LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatable milliamp selection for photon intensity (sold seperately)0-30 mA variable LED outputNon-magnetic LED baseChemically resistant LED coverPTFE coated cablingPhoto Kitalysis Starter Kitrequired for operation (sold separately). Best when used withKitAlysis Benchtop Inertion Box(sold separately)... Read More | This reagent kit uses an adsorption column that can specifically bind to viral RNA and a unique buffer system, suitable for isolating viral RNA from cell-free body fluids such as serum, plasma, urine, cerebrospinal fluid, and cell culture supernatants. The viral RNA specifically binds to the siliconThis reagent kit uses an adsorption column that can specifically bind to viral RNA and a unique buffer system, suitable for isolating viral RNA from cell-free body fluids such as serum, plasma, urine, cerebrospinal fluid, and cell culture supernatants. The viral RNA specifically binds to the silicon substrate membrane, and pollutants flow through the membrane. Completely remove impurities such as proteins through two efficient washes, and then wash high-purity viral RNA with RNase free water or RNase Free Water provided by the reagent kit. The virus RNA extracted by this kit can be directly used for experiments such as RT-PCR, Real time RT-PCR, and Western blot analysis. R666005Component50 TStorageR666005ABuffer GL15 mLRTR666005BBuffer RW140 mLRTR666005CBuffer RW2（concentrate）11 mLRTR666005DProteinase K12.5 mgRTR666005EProteinase K Storage Buffer1.25 mLRTR666005FRNase-Free Water10 mLRTR666005GSpin Columns RS with Collection Tubes50 setsRTR666005HRNase-Free Centrifuge Tubes（1.5 mL）50 EART Self prepared reagent: anhydrous ethanol, 0.9% NaCl.Preparation and important precautions before the experiment1. Add 1.25 ml of Protein K Storage Buffer to Protein K to dissolve it and store at -20 ℃. The prepared Protein K should not be left at room temperature for a long time to avoid repeated freeze-thaw cycles, which may affect its activity.2. To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.3. Serum or plasma should avoid repeated freeze-thaw cycles that may cause protein denaturation or precipitation, reduce viral titers, and thus affect the yield of extracted viral nucleic acids.4. Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. If buffer GL precipitates, it can be heated at 56 ℃ to dissolve and then placed at room temperature.6. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Operation steps1. Take 200 at room temperature µ Add serum or plasma to a 1.5 ml centrifuge tube (self provided). Attention: Less than 200 µ 0.9% NaCl (provided by the customer) can be added to make up for it.2. Add 20 to the solution in the previous step µ Protein K, mix well.3. Add 200 µ L Buffer GL, vortex oscillation for 15 seconds. Note: Do not directly add Protein K to Buffer GL. 4. Incubate at 56 ℃ for 15 minutes, briefly centrifuge, and collect the solution on the tube wall to the bottom of the tube.5. Add 250 µ Anhydrous ethanol, vortex for 15 seconds, incubate at room temperature for 5 minutes, briefly centrifuge, and collect the solution from the tube wall to the bottom of the tube.6. Add all the solution obtained in step 5 to the Spin Columns RS that have been loaded into the collection tube. If it is not possible to add all the solution to the adsorption column at once, please transfer it in two batches, centrifuge at 12000 rpm (~13400 × g) for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ Centrifuge at 12000 rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.8. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.9. Add 500 to the adsorption column µ Centrifuge anhydrous ethanol at 12000 rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube. 10. Centrifuge at 12000 rpm for 3 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Attention:1) The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).2) Recommended steps: Place the adsorption column into a new 1.5 ml centrifuge tube (provided), open the tube cover, and incubate in a 56 ℃ oven for 3 minutes to thoroughly dry the membrane of the adsorption column.11. Place the adsorption column in a new RNase free centrifuge tube and add 20-50 to the middle of the adsorption column in the air µ Place RNase Free Water at room temperature for 5 minutes, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 20 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 20-50 µ Repeat step 11 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 11... Read More |