| Description | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences theDescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences the reverse cholesterol transport pathway.Preparation instructionsSuitable for high-throughput screening (HTS), mechanism of action (MOA) studies, and structure-activity relationship (SAR) work in CETP sources.PrincipleThe CETP RP Activity Assay uses a proprietary substrate that enables the detection of CETP-mediated neutral lipid mass transfer. The method is useful for measuring CETP activity in recombinant protein (RP) or purified CETP samples and has a high D... Read More | This kit is suitable for extracting total RNA from fresh whole blood (blood samples treated with anticoagulants such as citrate, EDTA, or heparin). It can process up to 1.5 ml of whole blood and elute to obtain high-purity RNA with a molecular weight greater than 200 bp. Multiple samples can be This kit is suitable for extracting total RNA from fresh whole blood (blood samples treated with anticoagulants such as citrate, EDTA, or heparin). It can process up to 1.5 ml of whole blood and elute to obtain high-purity RNA with a molecular weight greater than 200 bp. Multiple samples can be completed simultaneously within 1 hour. This product does not require the ultra centrifugation step of CsCl purification and LiCl or ethanol precipitation. It does not contain toxic solvents such as phenol or chloroform. The purified RNA effectively removes enzyme inhibitors and pollutants such as heme and heparin. It can be directly used in various molecular biology routine experiments, such as RT-PCR, Northern Blot, Dot Blot, in vitro translation, and so on.Self prepared reagents: β- Mercaptoethanol, 70% ethanol (prepared with water without RNase), anhydrous ethanol. R666034 Component 50 T Storage R666034A Buffer RBL (10×) 60 mL RT R666034B Buffer RL 35 mL RT R666034C Buffer RW1 40 mL RT R666034D Buffer RW2 (concentrate) 11 mL RT R666034E RNase-Free Water 10 mL RT R666034F Spin Columns FL with Collection Tubes 50 sets RT R666034G Spin Columns RM with Collection Tubes 50 sets RT R666034H RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RT Preparation and important precautions before the experimentTo prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The sample should avoid repeated freezing and thawing, otherwise it will affect the yield and quality of RNA extraction. The sample can be stored in Buffer RL at -70 ℃ for one month.3. Before use, please check if there is any crystallization or precipitation in the Buffer RL. It can be dissolved again in a 56 ℃ water bath. Please add Buffer RL before use β- Mercaptoethanol, with a final concentration of 1%. Add 10 to 1 ml Buffer RL µ L β- Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month.4. Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. This reagent kit cannot be used for RNA extraction from frozen blood samples with anticoagulants added.6.10 × Buffer RBL needs to be diluted 10 times with water without RNase before use, and then stored at 2-8 ℃ after dilution.7. If downstream experiments are highly sensitive to DNA, it is recommended to treat RNA with DNase I that does not contain RNase.8. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Operation steps1. Add 5 times the volume of 1 x Buffer RBL to fresh anticoagulant whole blood samples of 0.5-1.5 ml (please dilute 10 x Buffer RBL with RNase free water before use), gently vortex or invert and mix well. Incubate on ice for 10-15 minutes, mix twice during the incubation process.Attention: During the incubation process, the cloudy suspension will become transparent, indicating that red blood cells have been lysed. If necessary, the incubation time can be extended to 20 minutes. 2. Centrifuge at 4 ℃, 2100 rpm (~400 × g) for 10 minutes, and carefully discard the supernatant.3. Add 2 times the volume of the blood sample to the above precipitate with 1 x Buffer RBL (please dilute 10 x Buffer RBL with RNase free water before use), gently vortex, and resuspend the precipitate thoroughly. 4. Centrifuge at 4 ℃ and 2100 rpm for 10 minutes, carefully and thoroughly remove the supernatant.Note: This step must completely remove the supernatant, otherwise it will affect the lysis and lead to a decrease in RNA production.5. Add Buffer RL to the precipitate (check if it has been added before use β- Mercaptoethanol, 0.5-1.5 ml of blood sample added to 600 µ L Buffer RL, or less than 0.5 ml of blood sample added to 350 µ L Buffer RL, mix well.6. Transfer the obtained liquid to the spin columns FL that have been loaded into the collection tube, centrifuge at 12000 rpm (~13400 × g) for 2 minutes, collect the filtrate, and discard the filter column.7. Add 1 volume (600) to the obtained filtrate µ L or 350 µ l) Mix 70% ethanol (prepared without RNase water) well.Attention: Adding ethanol may cause precipitation and will not affect subsequent experiments.8. Add all the solution obtained in the previous step to the spin columns RM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred in multiple batches. Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.9. Add 700 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.Optional steps: If conducting RNA experiments that are highly sensitive to trace amounts of DNA, replace step 9 with the following steps.1) Add 350 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.2) Preparation of DNase I mixture: Take 70 µ Reaction Buffer and 10 µ L DNase I storage solution, gently mix and prepare to a final volume of 80 µ The reaction solution of L.Attention: The above system is configured according to our company's DNase I (D665537) reaction system. Please refer to the corresponding manual for other company products.1) Add 350 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.2) Preparation of DNase I mixture: Take 70 µ Reaction Buffer and 10 µ L DNase I storage solution, gently mix and prepare to a final volume of 80 µ The reaction solution of L.Attention: The above system is configured according to our company's DNase I (D665537) reaction system. Please refer to the corresponding manual for other company products.3) Add 80 µ l of the prepared DNase I reaction solution directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.4) Add 350 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.10. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.11. Repeat step 10. 12. Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column in a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 13 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 13... Read More | Product content R669871Component50 TStorageR669871ADNase I1000 U-20℃. Avoid freeze/thaw cycle.R669871B10×Reaction Buffer1mL-20℃. Avoid freeze/thaw cycle. R669871CBuffer DS30 mLRTR669871DBuffer GTL15 mLRTR669871EBuffer GL25 mLRTR669871FProteinase K12.5 mgRTR669871GProteinase K Product content R669871Component50 TStorageR669871ADNase I1000 U-20℃. Avoid freeze/thaw cycle.R669871B10×Reaction Buffer1mL-20℃. Avoid freeze/thaw cycle. R669871CBuffer DS30 mLRTR669871DBuffer GTL15 mLRTR669871EBuffer GL25 mLRTR669871FProteinase K12.5 mgRTR669871GProteinase K Storage Buffer1.25 mLRTR669871HBuffer RW140 mLRTR669871IBuffer RW2 (concentrate)11 mLRTR669871JRNase-Free Water10 mLRTR669871KSpin Columns RS with Collection Tubes50 setsRTR669871LRNase-Free Centrifuge Tubes (1.5 mL)50 EART Product IntroductionThis kit is suitable for effectively purifying total RNA from formalin fixed and paraffin embedded tissues. Suitable for extracting total RNA with improved purity from paraffin embedded tissues or sections less than 30mg. This kit does not require the use of phenol/chloroform extraction or isopropanol precipitation, and can complete the extraction of multiple samples within one hour. This product uses specially optimized lysis solution and protease K to release RNA from formalin fixed or tissue slice samples without overnight operation; After digestion, the sample is incubated at a higher temperature to remove the inhibitory effect caused by formalin cross-linking, effectively releasing RNA from tissue slices and avoiding endangering RNA integrity; The optimized buffer system allows RNA in the lysis solution to specifically bind to the silica gel adsorption membrane, while other pollutants can flow through the membrane; It can be effectively removed through rinsing steps, and the washed RNA can be directly used for experiments such as RT-PCR, Real Time PCR, and Western blot analysis.Self prepared reagents: anhydrous ethanol (newly opened or dedicated for RNA extraction), 10mM PBS (pH 7.4).Preparation and important precautions before the experiment1. Add 0.625ml Protein K Storage Buffer to Protein K to dissolve it and store at -20 ℃. The prepared Protein K should not be left at room temperature for a long time to avoid repeated freeze-thaw cycles, which may affect its activity.2. To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.3. After obtaining the sample, it should be fixed in 4% -10% formalin as soon as possible, with a suitable fixation time of 14-24 hours. Excessive time can lead to RNA breakage and affect downstream experiments.4. Ensure that the sample before embedding is thoroughly dehydrated, as residual formalin will inhibit the action of Protein K.5. Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.Before use, please check if there is any crystallization or precipitation in Buffer GTL, Buffer GL, and Buffer DS. If there is any crystallization or precipitation, please dissolve Buffer GTL, Buffer GL, and Buffer DS again in a 56 ℃ water bath.Operation steps1. Sample processing1a. Paraffin embedded sample: Use a surgical knife to trim off excess paraffin from the tissue block, expose the tissue, and cut into 5-10 µ m thin slices.Attention: If the surface of the sample has already been exposed to air, please discard 2-3 pieces that come into contact with the air and do not use them.1b. Samples in fixed solutions such as formalin: Take approximately 20mg of the sample, cut it into small pieces, place it in a centrifuge tube, and add 500 µ 10mM PBS (PH7.4), vortex oscillation, centrifugation at 12000 rpm (~13400 × g) for 1 minute, discard the supernatant, repeat 3 times, and proceed directly to step 3.2. Choose option A or option B to remove paraffinOption AA1. Take approximately 1 × 1cm2 of slices (4-5 slices in total) and place them in a centrifuge tube (prepared by oneself), then add 500 slices µ L Buffer DS, vortex oscillation for 10 seconds. Incubate at 56 ° C for 3 minutes.Centrifuge at A2.12000 rpm for 2 minutes, be careful to discard the supernatant and avoid attracting sediment.Option BB1. Take approximately 4-5 slices of approximately 1 × 1 cm2 and place them in a centrifuge tube (self prepared). Add 1ml of xylene, cover the tube tightly, and vortex for 10 seconds.B2.Centrifuge at 12000 rpm for 2 minutes, be careful to remove the supernatant and avoid removing sediment.B3. Add 1ml of anhydrous ethanol, vortex and shake well. Centrifuge at 12000 rpm for 2 minutes, discard the supernatant, and be careful not to absorb or discard the sediment.B4. Open the tube cover and incubate at room temperature or up to 37 ° C for 10 minutes until there is no ethanol residue.3. Add 150µ L Buffer GTL, resuspended precipitation; Join 10µl Protein K, vortex oscillation mixing.4.Incubate at 56 ℃ for 15 minutes until the sample is completely dissolved. Incubate at 80 ℃ for 15 minutes. Short centrifugation allows the solution on the tube wall to be collected to the bottom of the tube.Note: 1) The purpose of this step is to repair nucleic acids denatured by formaldehyde. Incubating at a high temperature or for too long may cause RNA breakage, resulting in RNA fragments.2) The sample incubated at 56 ℃ can be placed at room temperature until the temperature of the water or dry bath reaches 80 ℃, and then the sample can be incubated at 80 ℃.5. Place on ice for 3 minutes, centrifuge at 12000 rpm for 15 minutes, transfer the supernatant to a new centrifuge tube, be careful not to suck sediment.6. Add 320 to the supernatant µ L Buffer GL, vortex oscillation thoroughly mixed.7. Join 720 µ Mix anhydrous ethanol thoroughly with vortex oscillation.Attention: After adding anhydrous ethanol, there may be a small amount of precipitate precipitation, but it does not affect subsequent operations.8. Add all the solutions obtained in step 7 to the spin columns RS that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Optional steps: If genomic DNA needs to be removed, the following steps can be followeda. Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 1 minute, discard the waste liquid, and place the adsorption column back into the recovery manifold.b. Preparation of DNase I mixture: Take 52 µ Add 8 RNase Free Water to it µ 10 x Reaction Buffer and 20 µ DNase I (1U/ µ l) Mix well and prepare to a final volume of 80 µ The reaction solution of L.c. Add 80 µ l of DNase I mixture directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.d. Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 1 minute, discard the waste liquid, and place the adsorption column back into the recovery manifold.9. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.10. Repeat step 9.Centrifuge at 11.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).12. Place the adsorption column in a new RNase free centrifuge tube, and add 20-50µl to the middle of the adsorption column in the air Place RNase Free Water at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -20 ℃.Note: 1) The volume of RNase Free Water should not be less than 20 µ l. Small volume affects the recovery rate. 2) If you want to increase RNA production, you can use 20-50 µ Repeat step 12 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 12... Read More | This kit is used to extract and purify high-quality total RNA from various plants, and is also suitable for the extraction of fungal hyphal RNA. A unique Shredder separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while silica based membrane is This kit is used to extract and purify high-quality total RNA from various plants, and is also suitable for the extraction of fungal hyphal RNA. A unique Shredder separation column is used for homogenization and filtration of high viscosity plant or fungal lysates, while silica based membrane is used to adsorb RNA for purification, effectively removing various pollutants such as polysaccharides through washing. The washed RNA can be directly used in various downstream experiments. RNA with a molecular weight greater than 200 bases was extracted using this reagent kit, with high purity and almost no DNA residue. If it is an RNA experiment that is very sensitive to trace amounts of DNA, the remaining DNA can be digested and removed on a column using DNase I without RNase. The extracted RNA can be used for experiments such as Northern Blot, Dot Blot, RT-PCR, and in vitro translation. R665489Component50 TStorageR665489ABuffer RL35 mLRTR665489BBuffer RLC35 mLRTR665489CBuffer RW140 mLRTR665489DBuffer RW2 (concentrate)11 mLRTR665489ERNase-Free Water10 mLRTR665489FSpin Columns FL with Collection Tubes50 setsRTR665489GSpin Columns RM with Collection Tubes50 setsRTR665489HRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents:β- Mercaptoethanol, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experiment:To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of RNA extraction.3. Please add Buffer RL before use β- Mercaptoethanol, with a final concentration of 1%. Add 10 to 1 ml Buffer RL µ L β Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month. No need to add buffer RLC when using it β- Mercaptoethanol.Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. If precipitation occurs in Buffer RL and Buffer RLC, please heat them to dissolve and place them at room temperature.6. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.7. If downstream experiments are highly sensitive to DNA, it is recommended to treat RNA with DNase I without RNase.Operation steps:1. Take 50-100 mg of fresh plant tissue, add liquid nitrogen and quickly grind it into powder.2. Collect the ground powder into a centrifuge tube (provided by oneself) and add 600 µ L Buffer RL (check if it is added before use) β- Sulfhydryl ethanol or Buffer RLC, vortex oscillation causes it to fully decompose.Attention:1) The main component of Buffer RL is guanidine isothiocyanate, which is suitable for the lysis of most plant tissues. However, in some plant tissues (such as corn endosperm), due to the unique secondary metabolites, guanidine isothiocyanate causes precipitation in the sample, resulting in poor RNA extraction efficiency. In this case, Buffer RLC can be added instead of Buffer RL.2) Incubating at 56 ℃ for 1-3 minutes helps with tissue lysis, but plants with high starch content should not be subjected to high-temperature incubation.3. Transfer all the liquid obtained in step 2 to the spin columns FL that have been loaded into the collection tube, centrifuge at 12000 rpm (~13400 × g) for 2 minutes, and transfer the supernatant from the collection tube to a new centrifuge tube (provided by oneself).Attention:1) When aspirating liquid, the tip of the gun can be cut off for easy sampling.2) Spin Columns FL can remove most of the fragments, but there will still be a small amount flowing out. After centrifugation, precipitation will form in the collection tube. When proceeding to the next step, be careful not to absorb the sediment.4. Add 0.5 times the volume of anhydrous ethanol to the clean cracking solution obtained in step 3 and quickly mix well. Attention: Adding ethanol may cause precipitation, but it does not affect subsequent experiments.5. Add all the solutions obtained in step 4 to the spin columns RM that have been loaded into the collection tube. If it is not possible to add all the solutions to the adsorption column at once, please transfer them in two separate steps. Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add 700 to the adsorption column µ Centrifuge at 12000 rpm for 1 minute, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube. Optional steps: If conducting RNA experiments that are highly sensitive to trace amounts of DNA, replace step 6 with the following steps.1) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.2) Preparation of DNase I mixture: Take 52 µ Add 8 RNase Free Water to it µ 10 x Reaction Buffer and 20 µ DNase I (1 U/ µ l) Mix well and prepare to a final volume of 80 µ The reaction solution of L.Attention:The above system is configured according to our company's DNase I reaction system. Please refer to the corresponding instructions for other company products.3) Add 80 µ l of DNase I reaction solution directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.4) Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 15 seconds, discard the waste liquid, and place the adsorption column back into the recovery manifold.7. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.8. Repeat step 7.Centrifuge at 9.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly dry the anhydrous ethanol in the column.Attention:The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column in a new RNase free centrifuge tube, and add 30-50 to the middle of the adsorption column in the air µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 10 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 10... Read More |