| Description | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665989Component240 TStorageN665989AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665989BlIndex N901-N924 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle.Note: The amount of individual primers used is 1 µl, each N7-endProducts contentN665989Component240 TStorageN665989AIndex N501 Primers for Illumina240 µL-20℃. Avoid freeze/ Thaw cycle.N665989BlIndex N901-N924 Primers for Illumina24×10 µL-20℃. Avoid freeze/ Thaw cycle.Note: The amount of individual primers used is 1 µl, each N7-end primer can perform 10 DNA library constructs, and each kit can perform 240 DNA library constructs. Products IntroductionThis kit is a companion kit to the transposase-based Rapid DNA Library Construction Kit for Illumina platform library construction. Each kit contains one N5 primer and 24 N7 primers, which can be used to prepare 24 different single-ended Index libraries. All reagents provided in the kits have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes;Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers. ProcedureFor the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol.Index N501 Primer for IlluminaIndex N901-N996 Primer for Illumina... Read More | Product content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligationProduct content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligation of DNA sticky or flush ends in 5 minutes at room temperature (25°C). The kit contains Quick T4 DNA Ligase and 2×Quick Ligation Reaction Buffer optimized for fast and efficient DNA ligation.The ligation efficiency of Quick Ligation is equivalent to 1 hour of conventional ligation with T4 DNA Ligase. The Quick Ligation products can be used directly in routine bacterial transformation experiments.matters needing attention1. This kit enables most of the linkage reactions to reach the reaction endpoint within 5 minutes or less at 25°C. Increasing the reaction time will not enhance the reaction efficiency. If you use the rapid connection reaction after 1 hour, the conversion efficiency will be significantly reduced; if the rapid connection reaction at 25 ℃ overnight, the conversion efficiency will drop to 75%.2. 2×Quick Ligation Reaction Buffer contains ATP, which should be thawed on ice and mixed thoroughly before use. It is recommended to freeze the buffer in small tubes for the first time, so as to avoid repeated freezing and thawing, which will affect the efficiency of DNA ligation.3. Since T4 DNA Ligase contains glycerol, which is sticky and easy to hang on the wall, it is recommended to collect the liquid to the bottom of the tube by centrifugation for a short period of time before use, and the tip of the lance should not go too deep into the liquid surface when taking samples to avoid sticking to the tip of the lance and causing losses.4. If the quick ligation product is used for electrotransformation, the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation, and it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation.Usage1. The reaction solution was prepared according to the following system:*The amount of Insert DNA used: the molar ratio of Vector DNA and Insert DNA is generally 1:3-1:8, and the appropriate molar ratio of Vector DNA and Insert DNA can be selected according to the experimental situation.Calculation of DNA molar number: DNA molar number (nmol)=DNA mass (ng)/( 660daltons x number of inserted DNA bases bp).2. mix gently and centrifuge briefly. react at 25°C for 5 minutes.Note: The reaction time should not exceed 15 minutes, otherwise the connection efficiency will be reduced.3. Do not perform heat inactivation reactions. Centrifuge instantly and collect the solution from the wall to the bottom of the tube.Note: Heat inactivation significantly reduces transformation efficiency due to the presence of PEG in the buffer.4. After the reaction, store the DNA ligation product at 0-4℃, and then carry out transformation experiments; you can also store the DNA ligation product at -20℃.Note: When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.5. Heat shock the ligation product to transform 50 µl of receptor cells or take 1-2 µl of ligation product to electroshock transform 50 µl of receptor cells.Note: 1) When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.(2) If the quick ligation product is used for electrotransformation, it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation because the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation... Read More | The commonly used method of eukarYOtic gene expression regulation research is the detection of reporter genes, and bioluminescence is the most commonly used and effective means of reporter gene detection. Luciferase can catalyze the conversion of the substrate luciferin and emit photons. This The commonly used method of eukarYOtic gene expression regulation research is the detection of reporter genes, and bioluminescence is the most commonly used and effective means of reporter gene detection. Luciferase can catalyze the conversion of the substrate luciferin and emit photons. This product provides a rapid, sensitive and stable detection method for the expression of Renilla luciferase reporter gene in mammalian cells. Product characteristic：1.Rapid : Cell lysis was completed within 10-15 min ；2.Convenience : The reagent is easy to prepare, and the sample detection steps are simple；Instruction：1. Cell lysis ( 1 ) Remove the culture medium and gently wash with PBS ( adherent cells can be directly performed this operation, suspension cells should be centrifuged to collect cells ). Add 1 × Lysis Buffer ( diluted component A with sterile water at 4 : 1 ) according to the following scheme, and then place the culture plate on a micro-oscillator at room temperature for 15 min to fully lyse the cells. Note : The pyrolysis products can be stored at room temperature for 6 h, and can be stored at − 70 °C for a long time ( the pyrolysis products cannot be repeatedly frozen and thawed ). ( 2 ) The pyrolysis products after full pyrolysis were centrifuged at 10000-15000 rpm for 3-5 min. After centrifugation, the supernatant was moved into a new EP tube for subsequent detection. 2. Preparation of working fluid ( 1 ) Restore all components to room temperature. ( 2 ) Dilute component C into renilla luciferase working solution with component B, and the dilution method is to add 1 µL C component to 49 µL B component. 3.chemiluminescence value detection ( 1 ) According to the operation instructions of the instrument, the instrument with chemiluminescence detection function was opened, such as multifunctional microplate reader. The parameters were set, the determination time was 10 s, and the determination interval was 2 s. ( 2 ) The cell lysis products were added to the measuring tube according to the volume of 20 ~ 100 µL ( keep the same amount of samples each time ). 1 × Lysis Buffer was blank control. ( 3 ) 100 µL renilla luciferase working solution was added to determine the RLU ( Relative light unit ) value ( Shaking mixing function is recommended for microplate reader ). Note : The renilla luciferase working solution cannot be stored for a long time. It is now ready for use and is used once. Component：RenillaLuciferase Lysis Buffer；RenillaLuciferase Assay Buffer；CoelenterazineMatters needing attention：Scope of application： Matters needing attention：1.Please instantaneously centrifuge the product to the bottom of the tube before use, and then carry out subsequent experiments ; 2.Due to the influence of temperature on the enzyme reaction, the sample and reagent should be measured after reaching room temperature. 3.The strongest wavelength of bioluminescence catalyzed by renilla luciferase is 480 nm, in order to prevent interference between holes, it is recommended to use white opaque orifice plate ;4. B component is recommended to carry out small batch packing according to the experimental requirements ; 5.It is recommended to use it now to avoid repeated freezing and thawing ; 6.For your safety and health, please wear experimental clothes and wear disposable gloves. Scope of application：Study on gene expression regulation and promoter... Read More |