| Description | Product contentS665868Component50 TStorageS665868ABuffer GL25 mLRTS665868BBuffer GW1 (concentrate)13 mLRTS665868CBuffer GW2 (concentrate)15 mLRTS665868DBuffer GE15 mLRTS665868EProteinase K2×1.25 mLRTS665868FSpin Columns DM with Collection Tubes50 setsRTProduct IntroductionThis kit is suitable Product contentS665868Component50 TStorageS665868ABuffer GL25 mLRTS665868BBuffer GW1 (concentrate)13 mLRTS665868CBuffer GW2 (concentrate)15 mLRTS665868DBuffer GE15 mLRTS665868EProteinase K2×1.25 mLRTS665868FSpin Columns DM with Collection Tubes50 setsRTProduct IntroductionThis kit is suitable for the extraction of genomic DNA from fresh saliva or saliva/preservation solution mixture.The purification process of this product does not require the use of toxic solvents such as phenol or chloroform, and ethanol precipitation is not necessary. The optimized buffer system enables DNA to bind heterogeneously to the silica matrix centrifugal adsorption column, and the inhibitors of PCR and other enzymatic reactions can be effectively removed by a two-step washing step, and finally eluted with a low-salt buffer or water to obtain high-purity DNA.The purified obtained can be directly used for enzyme digestion, PCR, Real-Time PCR, library construction, Southern Blot, molecular labeling and other downstream experiments.Self-contained reagent: anhydrous ethanolPre-experiment Preparation and Important Notes1. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller fragments of extracted DNA and a decrease in the amount extracted.2. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the label of the reagent bottle before first use.3. Before use, please check whether Buffer GL appears to be crystallized or precipitated.Redissolve in a 56°C water bath.4. If the downstream experiments are sensitive to RNA contamination, 4 µL DNase-Free RNase A can be added in step 3(100 mg/mL).5. For prolonged storage of salivary DNA at room temperature, our Salivary DNA Preservation Tubes are recommended.Operation steps1. Add 400 µL of saliva sample or saliva/preservation solution mixture.Note: 1) Saliva mixtures added to the preservation solution require a 50°C water bath for 1 hour or an empty 50°C temperature chamber for 2 hours prior to extraction.2) If an increase in sample volume is required, multiply the volumes of Proteinase K, Buffer GL, and anhydrous ethanol in Steps 2-4, and the liquid can be transferred in multiple times in Step 5.2. Add 40 µL of Proteinase K.3. Add 400µL Buffer GL, vortex and shake to mix thoroughly, and water bath at 56℃ for 15-30 minutes.Note: If RNA removal is required, add 4 µL of RNase A solution at a concentration of 100 mg/mL after the above steps are completed, vortex for 15 seconds, and leave at room temperature for 2 minutes.4. Centrifuge briefly to remove water droplets from the inside of the tube cap. Add 400 µL of anhydrous ethanol and mix well by vortexing and shaking. Centrifuge briefly.Note: 1) Vortex and shake to mix immediately after adding Buffer GL and anhydrous ethanol.The addition of Buffer GL and anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.2) A sol-gel product may be formed after GL and anhydrous ethanol, in which case vigorous shaking or vortexing is recommended.3) The solution obtained in the previous step is added to the adsorption column in the Collection Tube.5. (Spin Column DM) in the collection tube, and if the solution cannot be added all at once, it can be transferred in several times. centrifuge at 12,000 rpm (∼13,400 × g) for 1 min, pour off the waste solution in the collection tube, and put the adsorption column back into the collection tube.6. Add 500 µL of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.7. Add 500 µL of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).9. Place the adsorption column in a new centrifuge tube (supplied), add 50-200 µL of Buffer GE or sterilized water to the middle of the adsorption column overhanging the column, let it stand at room temperature for 2-5 minutes, and centrifuge at 12,000 rpm for 1 minute to collect the DNA solution.-20°C to preserve DNA.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent should ensure that its pH is 7.0-8.5 (you can use NaOH to adjust the pH of the water to this range), and the elution efficiency is not high when the pH is lower than 7.0.2) Buffer GE preheated in a 65-70°C water bath and incubated at room temperature for 5 min before centrifugation can increase the yield.3) Because DNA preserved in water is subject to acidic hydrolysis, for long-term storage, elution with Buffer GE and storage at -20°C is recommended... Read More | The aladdin 488 Caspase-3 live cell assay kit contains the aladdin 488 Caspase-3 substrate and the Ac-DEVD-CHO Caspase-3 inhibitor. aladdin 488 Caspase-3 Substrate provides an effective tool for detecting apoptosis based on Caspase-3 activity, suitable for fluorescence microscopy and flow cytometry.The aladdin 488 Caspase-3 live cell assay kit contains the aladdin 488 Caspase-3 substrate and the Ac-DEVD-CHO Caspase-3 inhibitor. aladdin 488 Caspase-3 Substrate provides an effective tool for detecting apoptosis based on Caspase-3 activity, suitable for fluorescence microscopy and flow cytometry. Compared with other fluorescent substrates or fluorescent inhibitors of Caspase based on ( FLICA ) analysis, aladdin 488 Caspase-3 Substrate does not inhibit the apoptosis process of intact cells while detecting Caspase-3 activity. Substrate is composed of fluorescent DNA dyes coupled with Caspase-3 DEVD recognition sequence. Substrate initially had no fluorescence and entered the cytoplasm through the cell membrane. In apoptotic cells, Caspase-3 cleaves the Substrate and releases high-affinity DNA staining, which migrates to the nucleus to label DNA and emits bright green fluorescence.Therefore, aladdin 488 Caspase-3 Substrate is bifunctional, which can not only detect Caspase-3 activity, but also visualize the morphological changes of the nucleus during apoptosis. Aladdin 488 staining can be fixed in formaldehyde and compatible with subsequent immunostaining experiments.Parameters:aladdin 488：Ex/Em = 500/530 nm (with DNA)Component：Points for attention：1.Please instantaneously centrifuge the product to the bottom of the tube before use, and then carry out subsequent experiments. 2.Cells can be co-stained with a final concentration of 1µM Hoechst 33342 dye to produce blue fluorescence staining of the nucleus ( Ex / Em = 346 / 460 nm ). 3.Aladdin 488 staining can be fixed by formaldehyde, but it is not compatible with methanol fixation. 4.Formaldehyde-fixed aladdin 488-stained cells can be treated with 0.1 % TritonX-100 for subsequent staining, but the brightness of the treated staining may be weakened. 5.Fluorescent dyes all have quenching problems, please try to avoid light to slow down the fluorescence quenching. 6.For your safety and health, please wear experimental clothes and wear disposable gloves.Scope of application：Caspase 3 kit and apoptosis detectionUsage:1. Experimental optimization: The experimental steps provided below are based on the endpoint detection system. Aladdin 488 Substrate can also be used for long-term cell incubation course research. Cell density, substrate concentration, and inhibitor concentration may need to be optimized. The optimal substrate concentration may be between 1-10 µ Between M. Cells can be incubated with substrates in culture medium, PBS, or other buffer of your choice. For adherent cells, we recommend replacing them with fresh culture media containing substrates to prevent background heterogeneity. The operation of changing the medium or washing the cells after substrate incubation is freely selectable.2. We suggest that you set the following controls:A. Negative control: cells that do not induce apoptosis;B. Positive control: cells that induce apoptosis;C. Inhibitor control: Induce cell apoptosis while incubating Caspase-3/7 inhibitors (or 10-30 minutes in advance), and finally add Aladdin 488 Caspase-3 substrate.3. The Caspase-3/7 inhibitor Ac-DEVD-CHO in the Ac-DEVD-CHO Caspase-3 inhibitor control kit can be used to confirm that Caspase-3/7 depends on the fluorescence signal of aladdin 488. For inhibitor control, the final concentration of the inhibitor should be at least twice the substrate concentration (e.g. when using 5 µ At substrate M aladdin 488, the concentration of Ac-DEVD-CHO is 10 µ M). Before adding the substrate, incubate Ac-DEVD-CHO at room temperature for 15-30 minutes. After adding the substrate, continue to retain the inhibitor in the incubation solution. Ac-DEVD-CHO is a reversible competitive inhibitor. In certain cell types, effective Caspase-3/7 inhibitors require the use of irreversible inhibitors, such as Z-DEVD-FMK, or the addition of inhibitors before or during apoptosis induction.4. Flow cytometry(1) Choose appropriate methods to induce cell apoptosis, with untreated cell samples as controls.(2) Adhering cells should be digested with trypsin or other methods before performing the aladdin 488 Caspase-3 experiment.(3) Resuspend cells with culture medium or buffer to achieve a cell density of 106 cells/mL(4) Suck 0.2 mL of cell suspension into a flow cytometry test tube.(5) Inhibitor control samples were treated with Ac-DEVD-CHO on cells (see 3 above) Ac-DEVD-CHO Caspase-3 inhibitor control.(6) 200 µ Add 5 to L cell suspension µ Substrate of 0.2 mM and immediately mix to achieve a substrate concentration of 5 µ M. The optimal substrate concentration for different cells may vary and requires analysis and optimization.(7) Incubate cells at room temperature in dark for 15-30 minutes.(8) Join 300 µ L-medium or PBS, analyzed by flow cytometry. Detect the channel for green fluorescence (Ex/Em=485/515 nm).5. Fluorescence microscope(1) Choose appropriate methods to induce cell apoptosis, with untreated cell samples as controls.(2) Inhibitor control samples were treated with Ac-DEVD-CHO on cells (see 3 above) Ac-DEVD-CHO Caspase-3 inhibitor control.(3) Using a solution containing 5 µ M Substrate's fresh culture medium or PBS is used to replace the cell culture medium (see 1 above) Experimental optimization). For the inhibitor control group, the inhibitor was incubated together with the substrate.(4) Incubate cells at room temperature for 30 minutes or longer.(5) Cells can be directly observed in culture media containing Substrate. For the endpoint analysis method, PBS was used to clean the cells, fluorescence microscopy was used to observe the cells, and a filter (Ex/Em=485/515 nm) was used to observe green fluorescence.6. Fluorescence enzyme-linked immunosorbent assay (ELISA) reader(1) Adherent cells grow in black 96 well plates; Suspend cells, adjust the density to 106 cells/mL, and divide 0.2 mL of cell suspension into one well.(2) Choose appropriate methods to induce cell apoptosis, with untreated cell samples as controls. Note: Cells may be processed in tubes or bottles and then transferred to a 96 well detection plate.(3) Inhibitor control samples were treated with Ac-DEVD-CHO on cells (see 3 above) Ac-DEVD-CHO Caspase-3 inhibitor control.(4) For suspended cells, directly add Substrate and mix well. For adherent cells, use a solution containing 5 µ M Substrate's fresh culture medium or PBS is used to replace the cell culture medium (see 1 above) Experimental optimization). For the inhibitor control group, the inhibitor was incubated together with the substrate.(5) Cells can be directly observed in culture media containing Substrate.(6) For suspended cells, gently shake to resuspend the cells. The fluorescence enzyme-linked immunosorbent assay instrument is set with an excitation wavelength of 488 nm and an emission wavelength of 520 nm. Suggest using bottom collection method for adherent cells. Changes in the density of adherent cells may lead to inaccurate readings... Read More | Product content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct IntroductionProduct content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct Introduction：This product is a specialized reagent kit for one-step Real Time RTqPCR using probe methods (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT qPCR reaction, reverse transcription and quantitative PCR are requiredConducted in the same reaction system, there is no need to add reagents or open the tube cap during the reaction process, avoiding contaminationThis has improved the efficiency of the experiment. This product has high detection sensitivity, strong fluorescence signal, and high signal-to-noise ratio, making it very suitable forDetection of RNA viruses and other trace amounts of RNA. The special buffering system it contains can enable reverse transcriptase to interact with DNA polymeraseMaximize the effectiveness and improve reaction efficiency. By using this product, a wider linear range can be obtained, which is beneficial for the target base Due to more accurate quantification, good repeatability, and high reliability.ROX dye is used to correct the fluorescence signal error generated between wells in quantitative PCR instruments, and is generally used for ABIReal Time PCR amplification equipment from companies such as Stratagene. The excitation optical systems of different instruments vary, thereforeThe concentration of ROX dye must be matched with the corresponding fluorescence quantitative PCR instrument.matters needing attention：1. Before using the reagents in this reagent kit, please gently mix them upside down to avoid foaming as much as possible, and use them after brief centrifugation. 2. This product uses RNA as a template for one-step RT-PCR experiments, and RNase contamination should be avoided during the operation process,2.It is recommended to perform RNA operations in a dedicated area, using specialized instruments and consumables. Operators should wear masks and disposable gloves and frequently change gloves. Experimental consumables should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours and sterilized under high pressure for 30 minutes before use.3. Each reagent in this kit should avoid repeated freezing and thawing as much as possible, as repeated freezing and thawing may lead to a decrease in product performance.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT qPCR reaction. When designing primers, GC content, primer length, and primer should be considered Due to factors such as location, secondary structure of PCR products, it is recommended to use professional primer design software for design.5. It is recommended to use specific probes in this reagent kit and use professional design software for design. Usage: The following examples are typical reaction systems and conditions. In practical operation, corresponding improvements and optimizations should be made based on the differences in template, primer structure, and target fragment size. (Please prepare the reaction solution on ice)1. Dissolve the RNA template, primers, 2xGoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix, and RNase Free Water and place them on ice for later use.2. PCR reaction system: reagent 25 µl Reaction system final concentration 2×GoldStar Probe One Step Buffer 12.5 µl 1× Forward Primer，10 µM 0.5 µl 0.2 µM 1） Reverse Primer，10 µM 0.5 µl 0.2 µM 1） Probe ，10 µM 0.5 µl 0.2 µM 2） GoldStar Probe One Step EnzymeMix 1.0 µl / RNA Template X µl 10 pg – 100 ng3） 50×Low ROX or High ROX （optional）4） 0.5 µl 1× RNase-Free Water up to 25 µl /Note: 1) Typically, the primer concentration is 0.2 µ M can achieve good results, ranging from 0.1 to 1.0 µ M serves as a reference for setting the range. 2) The concentration of the probe used is related to the fluorescent quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance. Please refer to the instrument manual or the specific usage requirements of each fluorescent probe for concentration adjustment during actual use.3) The amount of RNA templates is usually based on 10 pg-100 ng as a reference. Due to the different copy numbers of target genes contained in templates of different species, gradient dilution can be applied to the templates to determine the optimal template usage.4) The excitation optical systems of different instruments vary, and depending on the instrument used for fluorescence quantification, 50 x Low ROX or 50 x High ROX can be added.3. Mix well, centrifuge briefly, and collect the solution to the bottom of the tube.4. RT-PCR reaction conditions steps temperature time / Reverse Transcription 45℃ 10 min / PCR pre denaturation 95℃ 10 min / denaturation 95℃ 15s 30-40cycle Annealing/Extension 60℃ 45s 30-40cycleAttention:1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 5-10 minutes.2) It is recommended to use a two-step PCR reaction program. If good experimental results cannot be obtained due to the use of primers with lower Tm values, a three-step PCR amplification can be attempted. The annealing temperature should be set within the range of 56 ℃ -64 ℃ as a reference... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire |