| Description | DescriptionThe plasma protein lecithin:cholesterol acyltransferase (LCAT) catalyzes the transfer of an acyl group from the sn2 position of phosphatidylcholine to the 3-hydroxyl group of cholesterol forming cholesteryl ester. This activity occurs on the surface of high density lipoprotein (HDL) and DescriptionThe plasma protein lecithin:cholesterol acyltransferase (LCAT) catalyzes the transfer of an acyl group from the sn2 position of phosphatidylcholine to the 3-hydroxyl group of cholesterol forming cholesteryl ester. This activity occurs on the surface of high density lipoprotein (HDL) and the cholesteryl esters formed by LCAT are incorporated into the core of HDL.Preparation instructionsSuitable for high-throughput screening, mechanism of action studies and structureactivity relationship (SAR) work of LCAT in plasma and serumPrincipleThe LCFC-LCAT Acyltransferase Activity Assay is a fluorometric assay useful for measuring the acyltransferase activity of LCAT in serum or plasma. The method detects changes in LCAT free cholesterol (LCFC) levels in the sample without the use of c... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | G665573 Component 10 T Storage G665573A Buffer P1 30 mL RT G665573B Buffer P2 30 mL RT G665573C Buffer E3 30 mL RT G665573D Buffer PS 15 mL RT G665573E Buffer PW (concentrate) 10 mL RT G665573F Endo-Free Buffer EB 30 mL RT G665573G RNase A (10 mg/mL) 600 碌L RT G665573H Endo-Remover FX 10 EA G665573 Component 10 T Storage G665573A Buffer P1 30 mL RT G665573B Buffer P2 30 mL RT G665573C Buffer E3 30 mL RT G665573D Buffer PS 15 mL RT G665573E Buffer PW (concentrate) 10 mL RT G665573F Endo-Free Buffer EB 30 mL RT G665573G RNase A (10 mg/mL) 600 碌L RT G665573H Endo-Remover FX 10 EA RT G665573I Plungers 10 EA RT G665573J Spin Columns DX with Collection Tubes 10 EA RT G665573K Centrifuge Tubes (15 mL) 10 EA RTProduct IntroductionThis kit is specially designed for the efficient and rapid extraction of plasmids from 15-50 ml of bacterial fluids. On the basis of cell lysis by alkaline lysis method, it adopts unique silicon matrix membrane adsorption technology to bind plasmid DNA efficiently and exclusively, and each adsorption column can adsorb up to 250 µg of plasmid DNA; at the same time, it adopts a special buffer system and endotoxin removal filter to effectively remove endotoxin, genomic DNA, RNA, protein and other impurities. The plasmids obtained from this kit are of high purity and stable quality, and can be used for cell transfection, as well as DNA sequencing, PCR, in vitro transcription, endonuclease digestion and other experiments.Self-contained reagents: anhydrous ethanol, isopropanol.Pre-experiment Preparation and Important Notes1. All components are stable for 1 year in a dry, room temperature (15-30°C) environment, and longer by placing the adsorption columns at 2-8°C. Buffer P1 with RNase A is stable for 6 months at 2-8°C.2. Before the first use, add all of the RNase A solution to Buffer P1, mix well, and store at 2-8°C. Before use, it needs to be left at room temperature for a period of time, return to room temperature and then use.3. Anhydrous ethanol should be added to Buffer PW before the first use according to the instructions on the reagent bottle label.4. Please check Buffer P2 and Buffer E3 for crystallization or precipitation before use. If there is any crystallization or precipitation, the clarification can be restored by taking a water bath at 37℃ for a few minutes.5. Be careful not to touch Buffer P2 and Buffer E3 directly, and tighten the lid immediately after use.6. The amount and purity of extracted plasmid is related to the concentration of bacterial culture, strain type, plasmid size, plasmid copy number and other factors.7. The adsorption columns treated with Buffer PS should be used immediately to avoid leaving them for too long.Operation steps1.Take 15-50 ml of fresh bacterial solution from the overnight culture, add it to a centrifuge tube (self-prepared) and centrifuge at 5000 × g for 10 minutes to collect the bacteria, and aspirate all the supernatant as much as possible.2.Add 2.5 ml of Buffer P1 to the centrifuge tube in which the bacterial precipitate has been left (please check that RNase A has been added first) and suspend the bacterial precipitate by mixing thoroughly using a pipette or vortex shaker. Note: If the bacterial mass is not thoroughly mixed, it will affect the lysis effect and make the extraction amount and purity low.3.Add 2.5 ml of Buffer P2 to the centrifuge tube, mix gently up and down 8-10 times to fully lyse the organisms, and leave at room temperature for 3-5 minutes. At this point the solution should become clear and viscous. Note: Mix gently, do not shake vigorously, so as not to interrupt the genomic DNA and cause genomic DNA fragments to be mixed in the extracted plasmid. If the solution does not become clear, it suggests that the amount of bacteria may be too large and the lysis is not complete, and the amount of bacteria should be reduced.4.Add 2.5 ml of Buffer E3 to the centrifuge tube and mix immediately by turning up and down 8-10 times, at which time a white flocculent precipitate appears. Note: Buffer E3 should be mixed immediately after addition to avoid localized precipitation.5.Install the cap of the filter (Endo-Remover FX), transfer the solution obtained in step 4 to the filter, wait until the white flocculent precipitate floats on the upper layer of the solution, remove the cap of the filter, align the filter with a clean 15 ml centrifuge tube (supplied), and slowly push the handle (Plungers) to filter, so that as much as possible of the solution passes through, and the filtrate is collected in the centrifuge tube.6.Add 1/3 solution volume of isopropanol to the filtrate and mix upside down.7.Column Equilibrium: Add 1ml Buffer PS to the adsorption column (Spin Columns DX) that has been loaded into a 15ml centrifuge tube, centrifuge for 2 minutes at 2500 x g. Pour off the waste liquid from the centrifuge tube and put the adsorption column back into the centrifuge tube.8.The mixture of filtrate and isopropanol from step 6 was transferred to the equilibrated adsorption column (which had been loaded into a collection tube).9.Centrifuge at 2500 x g for 1 minute, pour off the waste solution in the collection tube and put the adsorption column back into the collection tube. Note: The maximum volume of the adsorption column is 4 ml, so the solution obtained in step 8 is passed through the column in 2 times.10.Add 2 ml of Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first), centrifuge at 2500 × g for 1 min, and pour off the waste liquid in the collection tube.11.Repeat step 10.12.The adsorbent column was put back into the collection tube and centrifuged at 2500 × g for 2 min, the waste liquid was poured off, and the column was left to dry at room temperature for 5 min.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with subsequent enzymatic reactions (digestion, PCR, etc.)13. Place the adsorption column in a new 15 ml centrifuge tube, add 0.5-1 ml Endo-Free Buffer EB to the middle of the adsorbent membrane, leave it at room temperature for 2-5 minutes, centrifuge it at 2500 × g for 2 minutes, and collect the plasmid solution into the centrifuge tube. -20°C to store the plasmid.Note: 1) In order to increase the recovery efficiency of the plasmid, the obtained solution can be reintroduced into the adsorption column, left at room temperature for 2-5 minutes, centrifuged at 2500 x g for 2 minutes, and the plasmid solution can be collected into a centrifuge tube.2) When the plasmid copy number is low or >10kb, Endo-Free Buffer EB can increase the extraction efficiency by preheating at 65-70°C in a water bath... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionMaterials included in the kit are designed to be used with the Hy-Energy′s PCTPro-2000 System. They also can be used for demonstration purposes and as standards during the development of novel hydrogen storage and battery materials |