| Description | Lipid peroxidation is the degradation of lipids that occurs as a result of oxidative damage and is a useful marker for oxidative stress. Polyunsaturated lipids are susceptible to an oxidative attack, typically by reactive oxygen species, resulting in a well-defined chain reaction with the productionLipid peroxidation is the degradation of lipids that occurs as a result of oxidative damage and is a useful marker for oxidative stress. Polyunsaturated lipids are susceptible to an oxidative attack, typically by reactive oxygen species, resulting in a well-defined chain reaction with the production of end products such as malondialdehyde (MDA). Lipid peroxidation may contribute to the pathology of many diseases including atherosclerosis, diabetes, and Alzheimer′s.Lipid peroxidation (MDA) assay kit has been used to determine the levels of malondialdehyde (MDA).Suitability: Suitable for the measurement of malondialdehyde (MDA) in a variety of samples including tissue, cells and plasmaPrinciple: In this kit, lipid peroxidation is determined by the reaction of MDA with thiobarbituric acid (TBA) to form a colorimetric (532 nm)/fluorometric (λex= 532/λem= 553 nm) product, proportional to the MDA present... Read More | Inquire | Product content: M665559Component50 TStorageM665559ABuffer GTT15 mLRTM665559BBuffer GL15 mLRTM665559CBuffer GW1（concentrate）13 mLRTM665559DBuffer GW2（concentrate）15 mLRTM665559EBuffer GE15 mLRTM665559FProteinase K1.25 mLRTM665559GSpin CoLumns DM with CoLLection Tubes50 Product content: M665559Component50 TStorageM665559ABuffer GTT15 mLRTM665559BBuffer GL15 mLRTM665559CBuffer GW1（concentrate）13 mLRTM665559DBuffer GW2（concentrate）15 mLRTM665559EBuffer GE15 mLRTM665559FProteinase K1.25 mLRTM665559GSpin CoLumns DM with CoLLection Tubes50 EART Product Introduction:This reagent kit is suitable for extracting high-purity total DNA from fresh or frozen mouse or rat tails. The method provided by this reagent kit is simple and feasible, and the purification process does not require phenol or chloroform extraction. It can obtain DNA fragments up to 50 kb, and can also effectively recover fragments of 100 bp. This reagent kit uses a unique lysis solution to effectively lyse mouse tail samples. The optimized buffer system efficiently binds the DNA generated after the lysis of mouse tail to the silica matrix adsorption column, while other pollutants can flow through the membrane; Inhibitors of PCR and other enzymatic reactions can be effectively removed through a two-step washing process, followed by washing with low salt buffer or water to obtain high-purity DNA. The purified DNA can be directly used for downstream experiments such as enzyme digestion, PCR, ReaL Time PCR, library construction, Southern BLot, and molecular labeling.Self prepared reagent: anhydrous ethanol.Preparation and important precautions before the experiment:1. Samples should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2.Before the first use, anhydrous ethanol should be added to BufferGW1 and BufferGW2 according to the instructions on the reagent bottle label.3. Before use, please check if there is any crystallization or precipitation in the Buffer GL. If there is any crystallization or precipitation, please dissolve the Buffer GL again in a 56 ℃ water bath.Operation steps:1. Take a tail of a rat or two mice with a length of 0.4-0.6 cm, grind it into fine powder in liquid nitrogen or cut it into pieces and place it in a centrifuge tube (provided by oneself). Join 180 µ L Buffer GTT, shake and mix well. Note: Ensure that the starting quantity of the organization does not exceed the recommended range.2. Add 20 µ L Protein K, vortex oscillation, thoroughly mix.3. Place in a 56 ℃ water bath until the tissue solution is completely clear. Generally, digestion is required for 6-8 hours. During the incubation process, vortex oscillation is required to evenly disperse the sample. Note: 1) If there is still gel like substance after incubation and vortex oscillation, digest overnight or add 20 more if necessary µ L Protein K digestion will not affect subsequent operations. 2) To remove RNA, add 4 after completing the above steps µ L 100 mg/mL RNase A solution, shake well and let stand at room temperature for 5-10 minutes.4.12000 rpm (~13400 × g) for 1 minute to remove undigested tissues similar to mouse hair. Transfer the supernatant to a new centrifuge tube (provided by oneself).5. Add 200 µ L Buffer GL, vortex oscillation, thoroughly mixed. Join 200 µ L anhydrous ethanol, vortex and shake, thoroughly mix. Short centrifugation allows the solution on the tube wall to be collected to the bottom of the tube.Attention: 1) After adding Buffer GL and anhydrous ethanol, immediately vortex and shake to mix well.2) If multiple samples are operated together, Buffer GL and anhydrous ethanol can be mixed in equal proportions and added to the samples together.3) The addition of Buffer GL and anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments.6. Add all the solutions obtained in step 5 to the adsorption column (Spin CoLumins DM) that has been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.8. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 8.9.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).10. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Note: 1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Incubating at room temperature for 5 minutes before centrifugation can increase yield.3) Use an additional 50-200 µ Re washing with L Buffer GE or sterilized water can increase yield.4) If you want to increase the final concentration of DNA, you can add the DNA eluent obtained in step 10 back onto the adsorption membrane and repeat step 10; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ L Buffer GE or off... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire |