| Description | This kit is used to extract miRNAs from various animal tissues, plant tissues and cells. The extracted miRNA molecule is complete and high purity, which is suitable for various molecular biology experiments such as Northern blot, real timepcr, miRNA microarray chip, in situ hybridization, This kit is used to extract miRNAs from various animal tissues, plant tissues and cells. The extracted miRNA molecule is complete and high purity, which is suitable for various molecular biology experiments such as Northern blot, real timepcr, miRNA microarray chip, in situ hybridization, RNase protection assay, etcComposition:Scope of application：Nucleic acid extraction and purificationInstruction：1.Experimental preparation：1.1.All reagents were prepared with DEPC-treated solvents. Please use RNase-free tip and centrifuge tube to avoid RNA degradation by RNase during extraction.1.2.70 % ethanol, -20C pre-cooling.2.Operational procedure：There is a slight difference in the operation of miRNA extraction from different samples. The specific steps are as follows :【 Extraction of miRNA from animal tissues】1.Take 20-40 mg tissue, transfer to a pre-cooled mortar, and add liquid nitrogen to grind into powder.Please click below to describe the amount of organization used :①RNA-rich tissue ( e.g. liver ) : no more than 30 mg②Tissues with low RNA content ( e.g., muscle ) : no more than 100 mg③When the amount of tissue used was less than 20 mg : the amount of R-I, R-II and isopropanol used was halved.④When the amount of tissue used was more than 40 mg : the use of R-I, R-II and isopropanol increased proportionally.2.Add 400 ul Buffer R-I, repeatedly aspirate 8-10 times with a syringe equipped with a 21-25 needle, and transfer to a 1.5 m : centrifuge tube ( provided in the kit ). 3.Add 150 µl BufferR-1l, swirl for 15-30 s, centrifuge at 12,000 X g for 5 min. [ Centrifugation at 4 °C is recommended ] 4.Take the supernatant to 1.5ml centrifuge tube, add 180 u anhydrous ethanol, mix evenly.5.The preparation tube was placed in a 2 m : centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and 12,000 X g was centrifuged for 1 min. [ 1 Centrifugation at 4 °C is recommended ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]6.Abandon the preparation tube, add 500µl isopropanol to the filtrate, and mix evenly.7.12,000Xg centrifuged for 10 min, discard the supernatant.8.Add 700µl 70 % ethanol ( pre-cooled at -20 °C ), centrifuged at 12,000Xg for 5min.9.The supernatant was discarded and dried at room temperature for 5-10 min.10.70 ul Buffer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute miRNA.【 Extraction of miRNA from plant tissue 】1.Take 30-150 mg tissue, transfer to a pre-cooled mortar, and add liquid nitrogen to grind into powder.Please click below to describe the amount of organization used :①Plant leaves : usually 10-80 mg② Plant fiber tissue : usually 100-150 mg③When the amount of plant leaf tissue was less than 30 mg : the amount of R-I, R-II and isopropyl alcohol used was halved.④When the amount of plant leaf tissue was more than 80 mg : the use of R-I, R-II and isopropanol increased proportionally.⑤When the amount of plant fiber tissue was more than 150 mg : the use of R-I, R-II and isopropanol increased proportionally.2.Add 400 ul BufferR-I, use a syringe with a 21-25 needle to repeatedly suck 8-10 times, and transfer to a 1.5mI centrifuge tube ( provided in the kit ). 3.Add 150 ul Buffer R-1I, vortex oscillation 15-30 s, 12.000 x g centrifugation 5 min. [ Centrifugation at 4 °C is recommended ]4.Take the supernatant to 1.5ml centrifuge tube, add 180 mountain anhydrous ethanol, mix evenly.The preparation tube was placed in a 2 mI centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and 12.000 xg was centrifuged for 1 min. It is recommended to centrifuge at 4 °C ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]Abandon the preparation tube, add 500µl isopropanol to the filtrate, and mix evenly.7.12,000xg high heart for 10 min, discard the supernatant.8.Add 700 ul 70 % ethanol ( -20 °C precooling ), 12,000 xg centrifuge for 5 min.9.The supernatant was discarded and dried at room temperature for 5-10 min.10.70 ul Buffer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute miRNA.【miRNA extraction from cells】Steps 1-3 According to the different ways of cell culture, two experimental methods, a or b, can be selected.a. Suspension cultured animal cells or cell suspension obtained from petri dishes or culture flasks or freshly isolated animal tissue single cell suspension :1a.Collect 2X 10 * -1X 10 ' cells, centrifuge 2,000Xg for 5 min, discard the supernatant ;2a. Add 400 µl Buffer R-I, repeatedly draw 8-10 times with a syringe containing 21-25 needles, and transfer to a 1.5 mI centrifuge tube ( provided in the kit ) ;3a. Add 150µl Buffer R1I, vortex oscillation 15-30s, 12.000Xg centrifugal 5min. [ build at 4 °C centrifugal ].b. Cells cultured on 96-well L, 24-well, 12-well or 6-well plates :Cells were collected from 96-well, 24-well, 12-well or 6-well culture plates, and the medium was discarded as much as possible, and 400 u / well Buffer R-I was added to each well, and the pipette gun was used to blow up and down 8-10 times ;2b.Transfer the above cell suspension to a 1.5ml centrifuge tube ( provided in the kit ), and repeatedly draw 8-10 times with a syringe containing 21-25 needles ;3b. Add 150 µl Bufflr R-II, swirl for 15-30 s, centrifuge for 5 min at 12,000 × g. [ Recommended at 4 °C ]4.Take the supernatant to 1.5ml centrifuge tube, add 180 mountain anhydrous ethanol, mixing evenly.5.The preparation tube was placed in a 2 ml centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and centrifuged at 12.000 Xg for 1 min. [ 1 Centrifugation at 4 °C is recommended ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]6.Abandon the preparation tube, add 500 u of isopropanol to the filtrate, and mix evenly.7.12,000Xg high heart for 10 min, discard the supernatant.8.Add 700µ70 % ethanol ( pre-cooled at − 20 °C ), centrifuged at 12,000 × g for 5 min.9.Abandon the supernatant, dry at room temperature for 5 - 10 min.10.70 ul Bufer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute mRNA.3.Flow chartMatters needing attention：Buffer R-I contains irritating compounds, when operating to wear latex gloves and glasses, to avoid contamination of the skin, eyes and clothes, be careful not to inhale the nose and mouth. If the skin, eyes, to immediately rinse with a lot of water or saline, if necessary, seek medical advice... Read More | Product Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 andProduct Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 and α1-4 fucosyl linkages in these substrates without the need to remove sialic acid moieties.For removing core fucose linked α-(1-6) to the core GlcNAc of a GlcNAc-GlcNAc disaccharide structure we recommend our Alpha-(1-6) Fucosidase.• Non-sialidase dependant hydrolysis of antennary fucose moieties• Effective on both glycopeptides and free glycans• Highly specific (α1-3,4 fucosylated glycans)• Kit includes enzyme plus reaction buffer.• Sufficient for up to 50 samplesα(1-3,4) Fucosidase is useful for:nbsp;nbsp;Fucose linkage determinationnbsp;nbsp;Deglycosylating glycoproteins with Lewis structuresContentsAlpha-(1-3,4)-Fucosidase – 200 mM citrate buffer pH 6 containing 250 mM NaCl5x Reaction Buffer – 250 mM sodium phosphate pH 6... Read More | Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) uses RedNucleus I staining to detect cell cycle. RedNucleus I is a far-infrared nucleic acid dye with cell membrane permeability, which can quickly enter living cells, specifically bind to DNA, and perform cell cycle detection on living cells without RNase digestion. Compared with the traditional PI staining method, the cells do not need to be broken or fixed, and the operation is simpler. RedNucleus I is a fluorescent dye of double-stranded DNA, and the fluorescence intensity after binding to double-stranded DNA is proportional to the content of double-stranded DNA. The intracellular DNA content can be measured by flow cytometry, and then the cell cycle analysis can be carried out according to the distribution of DNA content. After RedNucleus I staining, assuming that the fluorescence intensity of G0 / G1 phase cells is 1, the theoretical value of the fluorescence intensity of G2 / M phase cells containing two copies of genomic DNA is 2, and the fluorescence intensity of S phase cells undergoing DNA replication is between 1-2. In addition, RedNucleus I is compatible with dyes such as Horizon BV / BUV, FITC and R-PE, and can be periodically detected after sample staining.The kit is usually used to detect the cell cycle of cultured adherent or suspended cells. If it is used for cell cycle detection of tissues, the tissues must be digested into a single cell state.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. this product is applicable to the detection of living cells and fixed cell cycle with certain limitations. Whether it is applicable to different types of cells needs to be determined after testing. If fixation is needed, it is recommended to use ice bath pre cooling 75-80% ethanol -20 ℃ to fix cells overnight. 3. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Instruction： Experimental materials ( self-provided )：①cell lines or other cell samples ( self-prepared ) ；②This kit ; ③ trypsin ( self-prepared ) ;④ Cell culture medium containing FBS ( self-prepared ) ; Experimental procedure： 1.Preparation of cell samples : ( 1 ) ( This step is for adherent cells, if suspended cells, can be carried out directly step ( 2 ) ) Digest cells with trypsin, add cell culture medium, gently blow away cells, collected into the centrifuge tube. Note : The number of cells on the machine needs to reach 50,000 and above, so the initial number of cells collected needs to be sufficient. ( 2 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. Carefully remove the supernatant, add about 1 mL of ice bath pre-cooled 1 × staining buffer ( 10 × staining buffer diluted with diH2O at 1 : 10 ), re-suspend the cells. Repeat once. ( 3 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. After the supernatant was discarded, 1 mL of culture medium was added to re-suspend the cells ( for fixed cells, 1 × PBS can also be used to re-suspend ). Gently flick the bottom of the centrifuge tube to properly disperse the cells to avoid cell aggregation. 2.Staining : 4 µL of RedNucleus I staining solution was added to each tube of cell samples, slowly and fully mixed, and incubated at room temperature in dark for 20 min ( or incubated at 37 ° C in dark for 5-10 min ). The optimal incubation time of different cells is different, and the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect. 3.Flow cytometry detection and analysis : Excited at 638 nm by flow cytometry, it is recommended to detect in RL3 or FL4 channels, or use RL1 and RL2 channels. Cell DNA content analysis and light scattering analysis were performed using appropriate analysis software.Scope of application：Cell cycle detection... Read More | Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20&#Product contentG665801Component100 TStorageG665801A2×GoldStar Probe One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801BGoldStar Probe One Step EnzymeMix100 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801C50×High ROX50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.G665801DRNase-Free Water1.5 mL-20℃. Avoid freeze/ Thaw cycle. Product Introduction This product is a specialized kit for one-step Real-Time RT-qPCR using the probe method (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT-qPCR reaction, reverse transcription and quantitative PCR are carried out in the same reaction system, and there is no need to add reagents or open the cap of the tube during the reaction process, which avoids contamination and improves the experimental efficiency at the same time. With high detection sensitivity, strong fluorescence signal and high signal-to-noise ratio, this product is very suitable for the detection of RNA viruses and other trace RNA. The special buffer system contained in this product can maximize the effectiveness of reverse transcriptase and DNA polymerase at the same time and improve the efficiency of the reaction. A wider linear range can be obtained with this product, more accurate quantification of the target gene, good reproducibility and high confidence.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument. Instruments that do not require ROX calibration (G665836) Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96 and others. Instruments that require High ROX calibration (G665801) ABI Prism 7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, and others.matters needing attention1.Before using the reagents in this kit, please mix them gently by turning them up and down to avoid foaming as much as possible, and use them after brief centrifugation.2.This product uses RNA as the template for one-step RT-PCR experiment, RNase contamination should be avoided during operation, it is recommended to operate RNA in a special area, use special instruments and consumables, the operator with a mask and disposable gloves and often change the gloves, the experiment-related consumables should be processed with 0.1% DEPC (diethyl ether pyrocarbonate) aqueous solution for 12 hours at 37℃, and autoclaved for 30 minutes before use. The consumables should be treated with 0.1% DEPC (diethylpyrocarbonate) aqueous solution at 37℃ for 12 hours and autoclaved for 30 minutes.3.Repeated freezing and thawing of each reagent in this kit should be avoided as much as possible; repeated freezing and thawing may degrade the product performance.4.This kit must use specific primers, the choice of primers can be selected according to specific experiments, the good or bad primer design directly affects the results of RT-qPCR reaction, the design of primers need to consider the GC content, primer length, primer position, the secondary structure of the PCR product and other factors, it is recommended to use a professional primer design software for design.5.This kit is recommended to use specific probes, and it is recommended to use professional design software for designing.UsageThe following examples are conventional reaction systems and conditions, which should be improved and optimized according to the different templates, primer structures and target fragment sizes in actual operation. (Please prepare the reaction solution on ice.)1. Dissolve RNA template, primers, 2× GoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix and RNase-Free Water and set aside on ice.2. PCR reaction system:reagents25µl reaction systemfinal concentration2×GoldStar Probe One Step Buffer12.5µl1×Forward Primer, 10µM0.5µl0.2µM¹⁾Reverse Primer, 10µM0.5µl0.2µM¹⁾Probe, 10µM0.5µl0.2µM²⁾GoldStar Probe One Step EnzymeMix1.0µl RNA TemplateXµl10pg-100ng³⁾50 x Low ROX or High ROX (optional)⁴⁾0.5µl1×RNase-Free WaterUp to 25µlNote: 1) Usually, better results can be obtained with a primer concentration of 0.2 µM, and 0.1-1.0 µM can be used as a reference for setting the range.(2) The concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe for the adjustment of the concentration in actual use.(3) Usually the amount of RNA template is 10pg-100ng as a reference. Since the templates of different species contain different copy numbers of target genes, the templates can be diluted in gradient to determine the optimal amount of template to use.(4) The excitation optical system varies from instrument to instrument, choose to add 50×Low ROX or 50×High ROX according to the instrument using fluorescence quantification.3. Mix well, centrifuge briefly, and collect the solution at the bottom of the tube.4.RT-PCR reaction conditions:Note: 1) The hot start enzyme used in this product must be activated under the condition of pre-denaturation 95℃, 5-10min. 2) It is recommended to use the two-step PCR reaction program, if you can not get good experimental results due to the use of primers with lower Tm value, etc., you can try to carry out the three-step PCR amplification, and the annealing temperature should be set in the range of 56℃-64℃ as a reference... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |