| Description | Product content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct IntroductionProduct content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct Introduction：This product is a specialized reagent kit for one-step Real Time RTqPCR using probe methods (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT qPCR reaction, reverse transcription and quantitative PCR are requiredConducted in the same reaction system, there is no need to add reagents or open the tube cap during the reaction process, avoiding contaminationThis has improved the efficiency of the experiment. This product has high detection sensitivity, strong fluorescence signal, and high signal-to-noise ratio, making it very suitable forDetection of RNA viruses and other trace amounts of RNA. The special buffering system it contains can enable reverse transcriptase to interact with DNA polymeraseMaximize the effectiveness and improve reaction efficiency. By using this product, a wider linear range can be obtained, which is beneficial for the target base Due to more accurate quantification, good repeatability, and high reliability.ROX dye is used to correct the fluorescence signal error generated between wells in quantitative PCR instruments, and is generally used for ABIReal Time PCR amplification equipment from companies such as Stratagene. The excitation optical systems of different instruments vary, thereforeThe concentration of ROX dye must be matched with the corresponding fluorescence quantitative PCR instrument.matters needing attention：1. Before using the reagents in this reagent kit, please gently mix them upside down to avoid foaming as much as possible, and use them after brief centrifugation. 2. This product uses RNA as a template for one-step RT-PCR experiments, and RNase contamination should be avoided during the operation process,2.It is recommended to perform RNA operations in a dedicated area, using specialized instruments and consumables. Operators should wear masks and disposable gloves and frequently change gloves. Experimental consumables should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours and sterilized under high pressure for 30 minutes before use.3. Each reagent in this kit should avoid repeated freezing and thawing as much as possible, as repeated freezing and thawing may lead to a decrease in product performance.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT qPCR reaction. When designing primers, GC content, primer length, and primer should be considered Due to factors such as location, secondary structure of PCR products, it is recommended to use professional primer design software for design.5. It is recommended to use specific probes in this reagent kit and use professional design software for design. Usage: The following examples are typical reaction systems and conditions. In practical operation, corresponding improvements and optimizations should be made based on the differences in template, primer structure, and target fragment size. (Please prepare the reaction solution on ice)1. Dissolve the RNA template, primers, 2xGoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix, and RNase Free Water and place them on ice for later use.2. PCR reaction system: reagent 25 µl Reaction system final concentration 2×GoldStar Probe One Step Buffer 12.5 µl 1× Forward Primer，10 µM 0.5 µl 0.2 µM 1） Reverse Primer，10 µM 0.5 µl 0.2 µM 1） Probe ，10 µM 0.5 µl 0.2 µM 2） GoldStar Probe One Step EnzymeMix 1.0 µl / RNA Template X µl 10 pg – 100 ng3） 50×Low ROX or High ROX （optional）4） 0.5 µl 1× RNase-Free Water up to 25 µl /Note: 1) Typically, the primer concentration is 0.2 µ M can achieve good results, ranging from 0.1 to 1.0 µ M serves as a reference for setting the range. 2) The concentration of the probe used is related to the fluorescent quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance. Please refer to the instrument manual or the specific usage requirements of each fluorescent probe for concentration adjustment during actual use.3) The amount of RNA templates is usually based on 10 pg-100 ng as a reference. Due to the different copy numbers of target genes contained in templates of different species, gradient dilution can be applied to the templates to determine the optimal template usage.4) The excitation optical systems of different instruments vary, and depending on the instrument used for fluorescence quantification, 50 x Low ROX or 50 x High ROX can be added.3. Mix well, centrifuge briefly, and collect the solution to the bottom of the tube.4. RT-PCR reaction conditions steps temperature time / Reverse Transcription 45℃ 10 min / PCR pre denaturation 95℃ 10 min / denaturation 95℃ 15s 30-40cycle Annealing/Extension 60℃ 45s 30-40cycleAttention:1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 5-10 minutes.2) It is recommended to use a two-step PCR reaction program. If good experimental results cannot be obtained due to the use of primers with lower Tm values, a three-step PCR amplification can be attempted. The annealing temperature should be set within the range of 56 ℃ -64 ℃ as a reference... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Products contentN665954Component24 T96 TStorageN665954ATPS V136 µL144 µL-20℃. Avoid freeze/thaw cycle.N665954B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665954CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665954D2× Products contentN665954Component24 T96 TStorageN665954ATPS V136 µL144 µL-20℃. Avoid freeze/thaw cycle.N665954B5×FA Reaction Buffer96 µL384 µL-20℃. Avoid freeze/thaw cycle.N665954CTS Buffer72 µL288 µL-20℃. Avoid freeze/thaw cycle.N665954D2× PCR Mix600 µL2×1.2 mL-20℃. Avoid freeze/thaw cycle. * This kit is suitable for human genomic DNA library construction, the starting template DNA input amount is 1 ng, our company also has 50 ng and 5 ng of human genomic DNA starting transposase method library construction kit, in order to get a higher quality library, different starting amount of DNA is recommended to use different kits. Products IntroductionThis kit is developed for Illumina's high-throughput sequencing platform and provides the enzyme premix system and reaction buffer for genomic DNA library construction, including all components except PCR primers. Compared with the traditional library construction kits, this kit adopts the new transposase method for library construction, which can complete DNA fragmentation, end repair and junction reaction in one simple enzymatic reaction, significantly reducing the amount of template, reducing the number of experimental steps, and shortening the time of library construction; it adopts the high-fidelity DNA polymerase for library enrichment, and the preference-free PCR amplification can expand the coverage area of the sequence, which can be used for efficient and effective sequencing. The use of high-fidelity DNA polymerase for library enrichment and preference-free PCR amplification broadens the coverage area of the sequence and enables efficient preparation of DNA libraries for Illumina's second-generation sequencing platform. The kit is suitable for use with 1 ng of starting template DNA, and all reagents in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction.Product Features● DNA fragmentation and junction ligation in one step.● Ultra-fidelity amplification minimizes amplification preference.Provide your own instruments, kits and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. Library PCR primer kit: It is recommended to use Kangwei transposase method for second generation sequencing multi-sample primer kit.4. Anhydrous ethanol, deionized water (pH between 7.0 and 8.0).5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes.Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important Notes1. Avoid repeated freezing and thawing of reagents.2. PCR products are easily contaminated due to improper operation, resulting in inaccurate results. It is recommended to isolate the PCR reaction system preparation area from the PCR product purification area, and to use special pipettes to clean the experimental areas at regular intervals.3. Bead purification: the beads should be equilibrated to room temperature before use, all operations on the beads should be carried out at room temperature, 80% ethanol should be dispensed freshly, the beads should be rinsed and dried until the surface is free of liquid reflections and has a frosted appearance, insufficient drying of the beads will cause ethanol residue that will affect the subsequent experiments, and over-drying of the beads will affect the efficiency of DNA recovery.4. The kit is suitable for human genomic DNA library construction, if the DNA sample is a PCR product, it should be ensured that its length>.500 bp, since transposases do not work on DNA ends, it is recommended to extend the PCR product by 50-100 bp at each end of the PCR product to avoid low coverage of the ends for sequencing. Sample PreparationDNA purity requirement: A260/A280 = 1.8-2.0. Sample DNA: dissolved in ultrapure water.DNA quantification: Too much or too little DNA will affect the quality of the library. It is recommended to use Nano to test the purity of the genomic DNA and then use Qubit to test the concentration of the genome (do not use any absorbance-based assay for template quantification). Schematic diagram of DNA banking process procedureDNA fragmentation, junction reaction 1. Add the following reagents to a 200 µl PCR tube:2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Place the above PCR tubes in the PCR instrument with the hot cap on and program the reaction as follows:inactivation reactionAfter the DNA is fragmented, the enzyme is still in a high active state, so it should be removed from the PCR instrument immediately and terminated by adding the Reaction Termination Buffer, in order to prevent the DNA from being fragmented too much and resulting in smaller library fragments.1. Add 3 µl of TS Buffer to the PCR tube containing the fragmentation product.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube.3. Incubate at room temperature for 5 min, or if the room temperature is too low, place the reaction on a PCR instrument at 25°C with the thermal cover closed.PCR amplification1. Add the following reagents to a 200 µl PCR tube.2. Mix by gently blowing with a pipette and centrifuge briefly so that all components are collected at the bottom of the tube. 3. Place the above PCR tubes in the PCR instrument with the thermal cap open, and the reaction program is as follows:Selective recovery of library DNA fragmentsIt is recommended to use CombiVision Magnetic Beads DNA Purification and Recovery Kit for selective recovery of DNA fragments. When different sizes of DNA fragments are required, the amount of magnetic beads used is different, please refer to the attached table for the specific amount of magnetic beads used.(If using other brands of magnetic beads, you need to figure out the optimal amount of magnetic beads by yourself).Note: Amplification products can also be fragment length sorted and purified using the Gum Recovery Kit. If there is no special requirement for library length distribution, amplification products can also be purified directly from DNA fragments without selective recovery of DNA fragments as described on page 4 of the manual.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. Transfer the PCR products to a 1.5 ml centrifuge tube, rehydrate to 100 µl, add several volumes of magnetic beads equilibrated to room temperature, vortex for 5 seconds, and let stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, and carefully aspirate the supernatant and transfer it to a new 1.5 ml centrifuge tube.Note: Do not discard the top clear.4. Add several volumes of magnetic beads to the supernatant, vortex and shake for 5 seconds, then let stand at room temperature for 5 minutes.5. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant until the solution is clear, carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA.Note: Do not discard the beads.6. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.7. Repeat step 6 once.8. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 20 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.9. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube. Table: Suggested amount of magnetic beads for different segment selection recoveryLibrary DNA fragment purificationWe recommend the use of the Kangwei Century Magnetic Bead Method DNA Purification and Recovery Kit.1. CMPure should be equilibrated at room temperature for 30 min after shaking and mixing before use.2. 50 µl of magnetic beads equilibrated to room temperature were added to the PCR product, vortexed and shaken for 5 seconds, and then left to stand at room temperature for 5 minutes.3. Centrifuge briefly, place the tube on a magnetic rack to separate the beads from the supernatant solution until the solution is clear (approximately 3-5 minutes), carefully aspirate the supernatant and discard it, avoiding contact with the beads that have bound the target DNA. Note: Do not discard the beads.4. Continue to keep the centrifuge tube fixed on a magnetic rack and add 200 µl of freshly prepared 80% ethanol to the centrifuge tube and allow to stand at room temperature for 30 seconds, carefully discarding the supernatant.Note: When adding ethanol, the liquid must not be blown directly onto the beads.5. Repeat step 4.6. Keep the centrifuge tube fixed on a magnetic rack and leave to dry at room temperature until the surface of the beads is slightly cracked, add 25 µl of ddH2O to solubilize.Note: Do not over-dry the beads as this may affect the elution efficiency.7. Remove the tube from the magnetic rack, vortex to completely resuspend the beads, and allow to stand at room temperature for 5 minutes. Centrifuge briefly, place the tube on the magnetic rack until the solution is clear, and transfer the supernatant solution to a new tube. Library quality controlDetermination of library concentrationIn order to obtain high-quality sequencing results, accurate quantification of DNA libraries is required, and the first recommendation is to use Real-timePCR methods are used for absolute quantification of DNA libraries. Additionally, fluorescent dye methods such as the Qubit method or the fluorescent dye picogreen method can be used; do not use quantification methods based on absorbance measurements here. The following approximate formula can be used to convert the molar concentration of the DNA library.Library fragment distributionThe prepared DNA libraries can be detected by agarose gel electrophoresis or Agilent 2100 Bioanalyzer.Range of segment length distributions... Read More | Inquire |