| Description | This reagent kit is specially developed for one-step RT-PCR experiments. Reverse transcription and PCR are carried out in the same reaction system, without the need to add reagents or open the tube cap during the reaction process, which improves detection sensitivity and experimental efficiency This reagent kit is specially developed for one-step RT-PCR experiments. Reverse transcription and PCR are carried out in the same reaction system, without the need to add reagents or open the tube cap during the reaction process, which improves detection sensitivity and experimental efficiency while avoiding contamination. This kit includes a brand new high-efficiency reverse transcriptase, a fast hot start DNA polymerase, as well as reaction buffer suitable for reverse transcription and PCR amplification, and other components necessary for the experiment. The loss of activity of SuperRT reverse transcriptase RNase H reduces RNA degradation in reverse transcription reactions. This reverse enzyme has high reverse transcription efficiency and can perform good reverse transcription reactions on a small amount of RNA templates. The rapid hot start DNA polymerase used in PCR reaction has excellent performance of high amplification efficiency, strong specificity, and fast extension speed. The unique buffering system maximizes the efficiency of both reverse transcriptase and polymerase. The target product amplified using this reagent kit has an A base attached to the 3 'end, which can be directly used for T/A cloning.S665660Component100 TStorageS665660ASuperRT OneStep EnzymeMix50 µL-20℃. Avoid freeze/thaw cycle.S665660B2×SuperRT OneStep Buffer1.4 mL-20℃. Avoid freeze/thaw cycle.S665660CRNase-Free Water1.5 mL-20℃. Avoid freeze/thaw cycle. Notes:1. During the operation process, RNase contamination should be avoided to prevent RNA degradation or cross contamination during experiments. It is recommended to perform RNA operations in specialized areas, use specialized instruments and consumables, and have operators wear masks and disposable gloves, and frequently change gloves.2. Disposable plastic containers should be used as much as possible for experiments. If glass containers are used, they should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours, and sterilized under high pressure at 120 ℃ for 30 minutes before use. Alternatively, glass containers should be sterilized under dry heat at 180 ℃ for 60 minutes before use. The sterile water used in the experiment should be treated with 0.1% DEPC and then subjected to high-pressure sterilization.3. All reagents in this reagent kit should be gently mixed upside down before use, avoiding foaming as much as possible, and used after brief centrifugation. The enzymes involved should be returned to -20 ℃ as soon as possible after use to avoid repeated freeze-thaw cycles.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT-PCR reactions. When designing primers, factors such as GC content, primer length, primer position, and the secondary structure of PCR products need to be considered. It is recommended to use professional primer design software.Usage:1. Dissolve the RNA template, primers, OneStep RT-PCR Buffer, SuperRT OneStep RT-PCR EnzymeMix, and RNase Free Water and place them on ice for later use.2. Prepare the reaction system according to the following table: Reagent 25 µlReaction system Final concentration 2×SuperRT OneStep Buffer 12.5 µl 1× Forward Primer，10 µM 1 µl 0.4 µM Reverse Primer，10 µM 1 µl 0.4 µM SuperRT OneStep EnzymeMix 0.5 µl / RNA Template X µl 1 pg – 1 µg RNase-Free Water up to 25 µl / Attention: The primer concentration should be between 0.1 and 1.0 as the final concentration µ M serves as a reference for setting the range. In the case of low amplification efficiency, the concentration of primers can be increased; When non-specific reactions occur, the primer concentration can be reduced to optimize the reaction system.3. Vortex and shake well, centrifuge briefly, and collect the solution to the bottom of the tube.4. Preheat the thermal cycler to 45 ℃, place the PCR tube in the thermal cycler, and perform RT-PCR reaction.Reaction conditions: Step Temperature Time / Reverse transcription 45℃ 30 min / PCR pre denaturation 95℃ 2 min Denaturation 94℃ 30 s 30-40 cycles Anneal 55-65℃ 30 s 30-40 cycles Extend 72℃ 30 s 30-40 cycles Finally extended 72℃ 5 min /Attention:1) In general PCR experiments, the annealing temperature is 5 ℃ lower than the melting temperature Tm of the amplification primer, and the annealing time is generally 20-30 seconds. If the ideal amplification efficiency cannot be achieved, the annealing temperature should be appropriately reduced; When non-specific reactions occur, increase the annealing temperature to optimize the reaction conditions.2) The extension time is set based on the size of the amplified fragments, and the DNA Polymerase amplification efficiency contained in this product is 1 kb/30s.3) The number of cycles can be set based on the downstream application of the amplification product. Too few cycles, insufficient amplification; Multiple cycles increase the probability of mismatches and result in severe non-specific backgrounds. Therefore, while ensuring product yield, the number of cycles should be minimized as much as possible.5. After the reaction is complete, take 5 µ l of the reaction product, add an appropriate amount of loading buffer, and perform electrophoresis detection results... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Product content:E665636Component50 TStorageE665636ABuffer P115 mLRTE665636BBuffer P215 mLRTE665636CBuffer E315 mLRTE665636DBuffer PS15 mLRTE665636EBuffer PW (concentrate)10 mLRTE665636FEndo-Free Buffer EB10 mLRTE665636GRNase A (10 mg/mL)150 µLRTE665636HEndo-Remover FMwith Collection Tubes50 Product content:E665636Component50 TStorageE665636ABuffer P115 mLRTE665636BBuffer P215 mLRTE665636CBuffer E315 mLRTE665636DBuffer PS15 mLRTE665636EBuffer PW (concentrate)10 mLRTE665636FEndo-Free Buffer EB10 mLRTE665636GRNase A (10 mg/mL)150 µLRTE665636HEndo-Remover FMwith Collection Tubes50 EARTE665636ISpin Columns DMwith Collection Tubes50 EART Product Introduction:Endotoxins are a common pollutant in plasmid extraction. Due to the high sensitivity of eukaryotic cells to endotoxins, the presence of endotoxins in plasmids can greatly reduce the transfection efficiency of eukaryotic cells. This reagent kit provides a simple, fast, and efficient new method for extracting endotoxin free plasmids. The extracted plasmids remove endotoxins to the maximum extent possible and can effectively remove contamination of genomic DNA, RNA, proteins, etc. The operation is simple and convenient. This reagent kit is suitable for extracting 1-5mL of bacterial solution. On the basis of alkaline lysis of cells, it efficiently and specifically binds plasmid DNA through a new silicon-based membrane. Each adsorption column can adsorb up to 40% µ The plasmid DNA of g is effectively removed using a special buffer system and endotoxin removal filter column, effectively removing impurities such as endotoxins and proteins. The plasmid obtained from this kit has high purity and stable quality, making it particularly suitable for cell transfection. It can also be used for downstream experiments such as DNA sequencing, PCR, PCR based mutations, in vitro transcription, transformed bacteria, and endonuclease digestion.Self prepared reagents: anhydrous ethanol, isopropanol.Preparation and important precautions before the experiment：1. All components can be stably stored for 1 year in a dry, room temperature (15-30 ℃) environment. The adsorption column can be stored for a longer time at 2-8 ℃. Buffer P1 with RNase A added can be stably stored for 6 months at 2-8 ℃. 2. Before the first use, add all RNase A solution to Buffer P1, mix well, and store at 2-8 ℃. Before use, let it sit at room temperature for a period of time. After returning to room temperature, use.3.Before the first use, anhydrous ethanol should be added to the Buffer PW according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer P2 and Buffer E3. If there is any crystallization or precipitation, you can take a water bath at 37 ℃ for a few minutes to restore clarity.5. Be careful not to come into direct contact with Buffer P2 and Buffer E3, and immediately cover them tightly after use.6.The amount and purity of plasmid extraction are related to factors such as bacterial culture concentration, strain type, plasmid size, and plasmid copy number.Operation steps：1. Take 1-5 mL of overnight cultured bacterial solution and add it to a centrifuge tube (provided). Centrifuge at 13000 rpm (~16200 × g) for 30 seconds to collect bacteria, and try to discard all the supernatant as much as possible.2. Add 250 to the centrifuge tube containing bacterial sediment µ L Buffer P1 (please check if RNase A has been added first), mix thoroughly with a pipette or vortex oscillator, and suspend bacterial precipitation.Attention: If the bacterial blocks are not thoroughly mixed, it will affect the cracking effect, resulting in low extraction amount and purity.3. Add 250 to the centrifuge tube µ L Buffer P2, gently invert and mix 8-10 times, allowing the bacterial cells to fully lyse. Leave at room temperature for 3-5 minutes. At this point, the solution should become clear and viscous.Attention: Mix gently and do not shake vigorously to avoid interrupting genomic DNA and mixing genomic DNA fragments in the extracted plasmid. If the solution does not become clear, it indicates that the bacterial count may be too high and the lysis may not be complete. The bacterial count should be reduced.4. Add 250 to the centrifuge tube µ L Buffer E3, immediately invert and mix 8-10 times until white flocculent precipitates appear. Let it stand at room temperature for 5 minutes. Centrifuge at 13000 rpm for 5 minutes, extract the supernatant, and add it to a filter column (Endo Remove FM). Centrifuge at 13000 rpm for 1 minute to filter, and collect the filtrate in a centrifuge tube (self provided).Attention: After adding Buffer E3, it should be mixed evenly immediately to avoid local precipitation. 5. Add 225 to the filtrate µ Mix L isopropanol upside down.6. Column balance: Add 200 to the spin columns DM that have been loaded into the collection tube µ L Buffer PS, centrifuge at 13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Transfer the mixed solution of filtrate and isopropanol from step 5 to an equilibrium adsorption column (already loaded into a collection tube).8.13000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Attention: The maximum volume of the adsorption column is 750 µ L. If the sample volume is greater than 750 µ L can be added in batches. 9. Add 750 to the adsorption column µ L Buffer PW (please check if anhydrous ethanol has been added first), centrifuge at 13000 rpm for 1 minute, and discard the waste liquid in the collection tube.10. Place the adsorption column back into the recovery manifold and centrifuge at 13000 rpm for 1 minute. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).11. Place the adsorption column in a new collection tube and add 50-100 to the middle of the adsorption membrane µ L Endo Free Buffer EB, let it stand at room temperature for 2-5 minutes, centrifuge at 13000 rpm for 2 minutes, and collect the plasmid solution into a centrifuge tube- Store the plasmid at 20 ℃.Note: 1) To increase the efficiency of plasmid recovery, the obtained solution can be added back to the adsorption column, left at room temperature for 2-5 minutes, centrifuged at 13000 rpm for 2 minutes, and collected into a centrifuge tube.2) When the plasmid copy number is low or>10 kb, preheating the Endo Free Buffer EB in a water bath at 65-70 ℃ can increase the extraction efficiency... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product content: U665923Component50 T200 TStorageU665923ABuffer GTL15 mL60 mLRTU665923BBuffer GL15 mL50 mLRTU665923CBuffer GW1 (concentrate)13 mL52 mLRTU665923DBuffer GW2 (concentrate)15 mL70 mLRTU665923EBuffer GE15 mL60 mLRTU665923FProteinase K1.25 mL4×1.25 mLRTU665923GSpin Columns DM with Product content: U665923Component50 T200 TStorageU665923ABuffer GTL15 mL60 mLRTU665923BBuffer GL15 mL50 mLRTU665923CBuffer GW1 (concentrate)13 mL52 mLRTU665923DBuffer GW2 (concentrate)15 mL70 mLRTU665923EBuffer GE15 mL60 mLRTU665923FProteinase K1.25 mL4×1.25 mLRTU665923GSpin Columns DM with Collection Tubes50 EA200 EART Product Introduction:This reagent kit is suitable for extracting high-purity total DNA from various samples such as fresh or frozen animal tissues, cells, blood, bacteria, etc. This product can purify DNA fragments with a maximum molecular weight of 50 kb. The purification process does not require the use of toxic solvents such as phenol or chloroform, nor does it require ethanol precipitation. This reagent kit adopts an optimized buffer system to efficiently and specifically bind DNA from the lysis solution to the silica matrix centrifuge adsorption column. Inhibitors of PCR and other enzymatic reactions can be effectively removed through a two-step washing step. Finally, high-purity DNA can be obtained by washing with low salt buffer or water. The purified DNA can be directly used for downstream experiments such as enzyme digestion, PCR, Real Time PCR, library construction, Southern Blot, and molecular labeling.Self prepared reagent: anhydrous ethanolEnzymatic Lysis Buffer (preparation required for extracting genomic DNA from Gram positive bacteria).Self prepared reagent: Enzymatic Lysis Buffer Formula: 20 mM Tris, pH 8.0; 2 mM Na2 EDTA; 1.2% Triton self prepared reagent: X-100; Lysozyme with a final concentration of 20 mg/mL.Preparation and important precautions before the experiment:1. Samples should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2.If extracting the genome of bacterial cultures with a large accumulation of secondary metabolites or thick cell walls, it is recommended to collect samples early in the logarithmic growth phase.3.Before the first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in Buffer GTL and Buffer GL. If there is any crystallization or precipitation, please dissolve Buffer GL and Buffer GTL again in a 56 ℃ water bath.5. If downstream experiments are sensitive to RNA contamination, 4 can be added before adding Buffer GL µ RNase A of L DNase Free (100 mg/mL) was not provided in this kit.Operation steps：Genome extraction from blood and cell samples1. Material processing1a If the extracted material is mammalian anticoagulant blood (non nucleated red blood cells), it can be directly directed to 50-200 µ Add Buffer GTL to fresh or frozen anticoagulant blood samples to supplement up to 200 µ L;1b If the extracted material is anticoagulant blood from poultry, birds, amphibians, or lower level organisms, and their red blood cells are nucleated cells, take 5-10 µ L fresh or frozen anticoagulant blood samples, add Buffer GTL to supplement up to 200 µ L;1c The cells cultured on the wall should be first processed into a cell suspension (with a maximum extraction amount of 5 × 10 cells), centrifuged at 2000 rpm (400 × g) for 5 minutes, discarded from the supernatant, and added with 200 µ L GTL, oscillate until the sample is completely suspended;Note: To remove RNA, add 4 after completing the above steps µ RNase A solution with a concentration of 100 mg/mL was vortexed for 15 seconds and left at room temperature for 2 minutes.2. Add 20 µ L Protein K.3. Add 200 µ L Buffer GL, vortex oscillation thoroughly mixed, 56 ℃ water bath for 10 minutes.4. Temporarily centrifuge to remove water droplets from the inner wall of the tube cover. Join 200 µ L anhydrous ethanol, vortex and shake thoroughly to mix well. Short centrifugation.Attention: 1) After adding Bu ff er GL and anhydrous ethanol, immediately vortex shake and mix well.2) The addition of Bu ff er GL and anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments. Some organizations may form sol-gel products after adding Bu ff er GL and anhydrous ethanol, and it is recommended to perform severe shaking or vortex treatment at this time.5. Add all the solutions obtained in the previous step to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm (~13400 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 7.8.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).9. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Attention:1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Preheating the GE in a water bath at 65-70 ℃ and incubating it at room temperature for 5 minutes before centrifugation can increase yield; Use an additional 50-200 µ Re washing with GE or sterilized water can increase yield.3) If the final concentration of DNA needs to be increased, the obtained solution can be re added to the adsorption column, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with GE or sterilized water.4) Because DNA stored in water is affected by acidic hydrolysis, if long-term preservation is required, it is recommended to elute with Bu ff er GE and store at -20 ℃.Genome extraction from animal tissues1. Material processingIf the extracted material is animal tissue, take 25 mg (the amount of spleen tissue should be less than 10 mg); If the material is mouse tail, take a section of rat tail with a length of 0.4-0.6 cm or two sections of mouse tail with a length of 0.4-0.6 cm.1a. After liquid nitrogen grinding or cutting the sample into small pieces, place it in a 1.5 mL centrifuge tube and add 180 mL µ Label different samples with L Buffer GTL.1b If using a homogenizer to process the sample, add no more than 80% of the homogenizer to the sample before homogenization µ L Buffer GTL, add 100 after homogenization µ L Buffer GTL.Attention:1) Ensure that the quantity of each organization does not exceed the recommended range.2) The tissue samples can be ground with liquid nitrogen or homogenized with a homogenizer before adding Bu ff er GTL, which can increase the cracking efficiency.2. Add 20 µ L Protein K, vortex oscillation thoroughly mixes the sample. Take a 56 ℃ water bath until the tissue is completely lysed. During the incubation process, the centrifuge tube can be inverted or shaken periodically to disperse the sample.Attention:1) The digestion time varies for different tissues, usually taking 1-3 hours to complete. The tail of the mouse needs to be digested for 6-8 hours, and if necessary, overnight digestion will not affect subsequent operations.2) If there is still gel like substance after incubation and vortex oscillation, extend the incubation time at 56 ℃ or add another 20 µ L Protein K digestion.3) To remove RNA, add 4 after completing the above steps µ RNase A solution with a concentration of 100 mg/mL, vortex for 15 seconds, and leave at room temperature for 5-10 minutes.3. Add 200 µ L Buffer GL, vortex shake thoroughly and mix well, take a water bath at 70 ℃ for 10 minutes. Add 200 after brief centrifugation µ L anhydrous ethanol, vortex and shake thoroughly to mix well.Attention:1) After adding Bu ff er GL and anhydrous ethanol, immediately vortex and shake to mix well.2) The addition of Bu ff er GL and anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments. Some tissues (such as the spleen and lungs) may form sol-gel products after adding Bu ff er GL and anhydrous ethanol. In this case, it is recommended to perform vigorous shaking or vortex treatment.4. Centrifuge briefly and add all the solution obtained in step 3 to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm (~13400 × g) for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.5. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.6. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 6.7.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).8. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Attention:1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Preheating the GE in a water bath at 65-70 ℃ and incubating it at room temperature for 5 minutes before centrifugation can increase yield; Use an additional 50-200 µ Re washing with GE or sterilized water can increase yield.3) If the final concentration of DNA needs to be increased, the obtained solution can be re added to the adsorption column, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with GE or sterilized water.4) Because DNA stored in water is affected by acidic hydrolysis, if long-term preservation is required, it is recommended to elute with Bu ff er GE and store at -20 ℃. i ii Genomic extraction of blood and cell samples1. Bacterial sample pretreatment1a Gram negative bacteria(1) Take 1-5mL of bacterial culture (10 ^ -10 ^ cells, up to a maximum of 2 × 10 ^ cells) and place it in a centrifuge tube (self prepared). Centrifuge at 12000 rpm (~13400 × g) for 1 minute and try to aspirate the supernatant as much as possible.(2) Add 180 to the precipitate µ L Buffer GTL, shake to suspend bacterial weight.(3) Join 20 µ L Protein K, vortex mix well, incubate at 56 ° C until the bacterial cell is completely lysed, and during the incubation process, invert or shake the centrifuge tube periodically to disperse the sample.Note: To remove RNA, add 4 after completing the above steps µ L RNase A solution with a concentration of 100 mg/mL, shake well and let stand at room temperature for 5-10 minutes.(4) Join 200 µ L Buffer GL, vortex oscillation mixing.1b Gram positive bacteria(1) Take 1-5 mL of bacterial culture (10 ^ -10 ^ cells, maximum not exceeding 2 x 10 ^ cells) and place it in a centrifuge tube (self prepared). Centrifuge at 12000 rpm for 1 minute and try to aspirate the supernatant as much as possible.(2) Join 180 µ L Enzymatic Lysis Buffer (self provided) suspends the bacterial weight.(3) Incubate at 37 ℃ for 30 minutes.(4) Join 20 µ L Protein K vortex oscillation, thoroughly mixed. Join 200 µ L Buffer GL, vortex oscillation mixing. Incubate at 56 ℃ for 30 minutes.Attention:1) If necessary, incubation at 95 ° C for 15 minutes can inactivate the pathogen, but incubation at 95 ° C can cause some DNA degradation.2) To remove RNA, add 4 after completing the above steps µ L RNase A solution with a concentration of 100 mg/mL, shake well and let stand at room temperature for 5-10 minutes.2. Add 200 µ L anhydrous ethanol, vortex and shake thoroughly to mix well.Attention: Adding anhydrous ethanol may produce white precipitates, which will not affect subsequent experiments.3. Add all the solution obtained from step 2 (including the formed precipitate) to the adsorption column (Spin Columns DM) that has been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.4. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.5. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.Note: To further improve DNA purity, repeat step 5.6.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).7. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃.Attention:1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high.2) Preheating the GE in a water bath at 65-70 ℃ and incubating it at room temperature for 5 minutes before centrifugation can increase yield; Use an additional 50-200 µ Re washing with GE or sterilized water can increase yield.3) If the final concentration of DNA needs to be increased, the obtained solution can be re added to the adsorption column, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute; If the elution volume is less than 200 µ L. It is possible to increase the final concentration of DNA, but it may reduce the total yield. If the amount of DNA is less than 1 µ g. Recommended 50 µ Wash with GE or sterilized water.4) Because DNA stored in water is affected by acidic hydrolysis, if long-term preservation is required, it is recommended to elute with Bu ff er GE and store at -20 ℃... Read More |