| Description | V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes 50 RT V669947H RNase-Free Centrifuge Tubes (1.5 mL) 50 RTProductsThis kit is suitable for the extraction of viral RNA and DNA from fresh or frozen plasma, serum and cell-free body fluids. It is easy to operate as it does not require the use of organic solvents such as phenol and chloroform for extraction. The kit uses a unique buffer system to enable efficient and specific binding of viral nucleic acids in lysate to silica gel centrifugal adsorption columns. Inhibitors of PCR and enzyme reactions as well as residual impurities can be efficiently removed in a two-step effective rinsing step, and finally high purity viral nucleic acids can be obtained by using a low-salt buffer or water for elution. The purified viral nucleic acid is free of protein, nuclease and other impurities, and can be used directly in PCR, RT-PCR, Real-Time PCR, blotting experiments and so on.Self-contained reagent: anhydrous ethanol.Pre-experiment and Important Notes1. Add 1.25ml Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity. Do not add Proteinase K directly into Buffer GL.2. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller DNA fragments and a decrease in the amount of extracted DNA.3. Avoid repeated freezing and thawing of serum or plasma, which can lead to protein denaturation or precipitation, reducing the viral titer and thus affecting the yield of extracted viral nucleic acids.4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the label instructions of the reagent bottle before first use.5. Check Buffer GL for crystallization or precipitation before use. If crystallization or precipitation occurs, redissolve Buffer GL in a water bath at 56℃.Procedure1. Take a 1.5 ml centrifuge tube (self-provided) and add 20 µl Proteinase K.2. Add 200 µl serum or plasma to the centrifuge tube. Add 200µl Buffer GL and vortex and shake for 15 seconds.Note: 1) Sample volume less than 200 µl can be made up by adding 0.9% NaCl (self-provided). 2) In order to ensure effective lysis of the sample, the sample needs to be mixed well with Buffer GL after adding Buffer GL.3. Incubate at 56°C for 15 minutes, centrifuge briefly, and collect the solution from the wall of the tube to the bottom of the tube.4. 250 µl of anhydrous ethanol was added, vortexed and shaken for 15 seconds, left at room temperature for 5 minutes, centrifuged briefly, and the solution on the wall of the tube was collected at the bottom of the tube.Note: If the ambient temperature exceeds 25°C, anhydrous ethanol should be used after pre-cooling on ice.5. Add the solution obtained in step 4 to the adsorbent column (RNase-Free Columns RS) that has been loaded into the collection tube, and if the solution cannot be added at one time, it can be transferred in several times. centrifuge the column at 12,000 rpm (~13,400 × g) for 1 min, pour off the waste liquid in the collection tube, and put the column back into the collection tube.6. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Add 500 µl of anhydrous ethanol to the adsorbent column and centrifuge at 12,000 rpm for 1 min. Pour off the waste liquid in the collection tube and put the adsorbent column back into the collection tube.9. Centrifuge at 12,000 rpm for 3 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is the removal of residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).10. Place the adsorption column in a new collection tube (RNase-Free Centrifuge Tube), add 20-150 µl of Buffer RE or sterilized water overhanging the middle of the adsorption column membrane, leave it at room temperature for 2-5 minutes, and then centrifuge it at 12,000 rpm for 1 minute to collect the nucleic acid solution.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent it should be ensured that its pH is 7.0-8.5 (the pH of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH is lower than 7.0.(2) For long-term storage, please store the DNA solution at -20℃ and the RNA solution at -70℃.3) If the final concentration of DNA/RNA is to be increased, the DNA/RNA eluate obtained in step 10 can be re-spiked onto the adsorbent membrane and step 10 repeated... Read More | Products B669892Component50 TStorageB669892ABuffer RCL3×260 mL2-8℃B669892BBuffer GR25 mLRTB669892CBuffer GL25 mLRTB669892DBuffer GW1 (concentrate)13 mLRTB669892EBuffer GW2 (concentrate)15 mLRTB669892FBuffer GE15 mLRTB669892GProteinase K50 mgRTB669892HProteinase K Storage Buffer5 Products B669892Component50 TStorageB669892ABuffer RCL3×260 mL2-8℃B669892BBuffer GR25 mLRTB669892CBuffer GL25 mLRTB669892DBuffer GW1 (concentrate)13 mLRTB669892EBuffer GW2 (concentrate)15 mLRTB669892FBuffer GE15 mLRTB669892GProteinase K50 mgRTB669892HProteinase K Storage Buffer5 mLRTB669892ISpin Columns DL with Collection Tubes50 setsRTProductsThis kit is suitable for the extraction of total DNA, including genomic DNA, mitochondrial DNA and viral DNA, from fresh or frozen whole blood (blood samplestreated with anticoagulants such as citrate, EDTA or heparin), plasma, serum, haematocrit brown and yellow layers, bone marrow, cell-free body fluids, etc. Theproduct can process 1-5 ml of whole blood, and can be purified to obtain sizes rangingfrom 100bp to 50kb. The purified DNA is of high yield and good quality, with maximumremoval of proteins, pigments, lipids and other inhibitory impurities, and can bedirectly used in PCR, fluorescence quantitative PCR, enzyme digestion and SouthernBlot.Self-contained reagent: anhydrous ethanol.Pre-experiment Preparation and Important Notes1. Add 5ml Proteinase K Storage Buffer to Proteinase K to dissolve it, and storeit at -20℃. Do not leave the prepared Proteinase K at room temperature for a longtime, and avoid repeated freezing and thawing to avoid affecting its activity.2. Repeated freezing and thawing of the sample should be avoided, as this may resultin smaller DNA fragments and a decrease in the amount of extracted DNA. 3.This kit can extract up to 1-5 ml of whole blood samples, if you need to extracta large number of blood samples, please use the blood genome non-column extractionkit. 4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to theinstructions on the label of the reagent bottle before first use.5. Please check Buffer GL for crystallization or precipitation before use, if thereis any crystallization or precipitation, please put it in 56℃water bath to re-dissolve.6. If the downstream experiments are sensitive to RNA contamination, 4µl of DNaseFree RNase A (100mg/ml) can be added, RNase A is not provided in the kit, and canbe ordered separately from our company if needed.7. The Buffer RCL in the kit cannot be used further after turbidity.procedure1. Add 1-5 ml of blood sample to a centrifuge tube (supplied) and add 3 times thevolume of Buffer RCL and gently vortex or invert to mix.2. Centrifuge at 3000 rpm (~900 x g) for 10 minutes and carefully aspirate thesupernatant.3. Add 400 µl Buffer GR to the precipitate and resuspend the precipitate. Note: If the downstream assay is sensitive to RNA, add 4 µl of RNase A (100 mg/ml)solution, shake for 15 seconds, and leave at room temperature for 5 minutes.4. For 1-2 ml blood sample extraction, add 40µl Proteinase K to the above solutionand mix well; for 2-5 ml blood sample extraction, add 100µl Proteinase K to theabove solution and mix well.5. Add 400 µl of Buffer GL, mix upside down 15 times, and vigorously vortex andshake for at least 1 minute. Note: Do not add Proteinase K directly to Buffer GL.6. Incubate at 70°C for 10 minutes, during which time mixing was inverted severaltimes.Note: 1) If the solution is not completely clear, add appropriate amount of Proteinase K and incubate. Extend the incubation time until the solution is completely clear. 2) The yield of DNA has been maximized by 10 minutes of incubation, and continuedprolongation of the incubation time has no effect on DNA yield or purity.7. Add 400 µl of anhydrous ethanol and mix upside down 10 times. Centrifuge brieflyto concentrate the liquid on the walls and cap to the bottom of the tube.8. Add all of the solution obtained in the previous step to the Spin Columns DL inthe collection tube. If the solution cannot be added all at once, transfer it severaltimes. centrifuge at 12,000 rpm (~13,400 x g) for 1 minute, pour off the waste liquidfrom the collection tube, and put the column back into the collection tube.9. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanolis added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquidin the collection tube, and put the adsorption column back into the collection tube.Note: It is recommended that step 9 be repeated if the sample being extracted isthe blood genome of a species such as mice or monkeys from which hemoglobin isdifficult to remove.10. Add 500 µl Buffer GW2 to the adsorption column (check that anhydrous ethanolis added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquidin the collection tube, and put the adsorption column back into the collection tube.Note: Step 10 can be repeated if further DNA purity is required.11. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in thecollection tube. Leave the adsorption column at room temperature for several minutesto dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorptioncolumn, which can interfere with subsequent enzymatic reactions (digestion, PCR,etc.)12. Place the adsorption column in a new centrifuge tube, add 50-200 µl of BufferGE or sterilized water to the middle of the adsorption column overhanging the column,leave it at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute,collect the DNA solution, and store the DNA at -20℃.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on theelution efficiency, if water is used as the eluent should ensure that its pH is7.0-8.5 (you can use NaOH to adjust the pH of the water to this range), and the elutionefficiency is not high when the pH is lower than 7.0.2) Incubation at room temperature for 5 minutes prior to centrifugation increasesyield.3) Re-elution with an additional 50-200 µl Buffer GE or sterilized water can increase the yield.4) If the final concentration of DNA is to be increased, the DNA eluate obtainedin step 12 can be re-spiked onto the adsorbent membrane and centrifuged at 12,000rpm. 1min; if the elution volume is less than 200µl, the final concentration of DNA canbe increased, but the total yield may be reduced. If the amount of DNA is less than1 µg, elution with 50 µl Buffer GE or sterilized water is recommended.5) Because DNA preserved in water is subject to acidic hydrolysis, for long-termstorage, it is recommended that it be eluted with Buffer GE and stored at -20℃... Read More | This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. This reagent kit is for research purposes only. Purpose of use: This reagent kit is used to determine the content of lactose in serum, plasma, and related liquid samples.Experimental principle:This kit applies enzyme-linked immunosorbent assay to determine the level of lactose in the sample. Purified lactose antibodies were coated on a microplate to produce solid-phase antibodies. Lactose was added to the microplate of the coated monoclonal antibody, along with HRP labeled lactose antigens, to compete for binding. After thorough washing, the substrate TMB was added for colorimetry. The depth of sample color is negatively correlated with the content of lactose in the sample. Measure the absorbance (OD value) at a wavelength of 450nm using an enzyme-linked immunosorbent assay (ELISA) reader, and calculate the content of lactose in the sample through a standard curve.Kit composition:130times concentrated washing solution20ml×1 bottle8.1Standard S1（80µg/L）0.5ml×1bottle2Enzyme-linked immunosorbent assay6ml×1 bottle8.2Standard S2（40µg/L）0.5ml×1bottle3Enzyme labeling coated plate96 holes x 1 pieces8.3Standard S3（20µg/L）0.5ml×1bottle4Color reagent A solution6ml×1 bottle8.4Standard S4（10µg/L）0.5ml×1bottle5Color developer B solution6ml×1 bottle8.5Standard S5（5µg/L）0.5ml×1bottle6Stop solution6ml×1 bottle9Instructions1 copy7Sample Diluent6ml×1 bottle10Microplate Sealers2 sheetsSpecimen requirements:1. Specimen processing:(1) After collecting the water sample, it is repeatedly freeze-thawed three times at -20 ℃, and then filtered through glass fiber for future reference(2) The tissue samples should be extracted using butanol: methanol: water (5:25:70 V: V: V), or extracted according to relevant literature. The experiment should be conducted as soon as possible after extraction. If the experiment cannot be conducted immediately, the specimen can be stored at -20 ℃ for future reference2. Samples containing NaN3 cannot be detected as NaN3 inhibits the activity of horseradish peroxidase (HRP).Operation steps:1. Sample addition: Set up standard wells, blank wells (blank control wells do not include samples and enzyme-linked immunosorbent assay reagents, the other steps are the same), and sample wells to be tested. Add 50 microliters to the standard well on the enzyme-linked immunosorbent assay (ELISA) plate, and first add 40 diluents to the sample well to be tested µ l. Then add 10 more samples to be tested µ L (The final dilution of the sample is 5 times). Add the sample to the bottom of the enzyme-linked immunosorbent assay (ELISA) plate well, avoiding touching the well wall as much as possible. Gently shake and mix well.2. Enzyme addition: Add 50 enzyme labeled reagents to each well µ l. Excluding blank holes.3. Warm incubation: Seal the plate with a sealing film and incubate at 37 ℃ for 60 minutes.4. Solution preparation: Dilute 30 times the concentrated washing solution with distilled water and set aside for later use5. Washing: Carefully remove the sealing film, discard the liquid, shake dry, fill each well with washing solution, let it stand for 30 seconds, then discard. Repeat this process 5 times and pat dry.6. Color development: Add color development agent A50 to each well first µ l. Add color developer B50 again µ l. Gently shake and mix well, and develop color at 37 ℃ in the dark for 15 minutes7. Termination: Add 50% termination fluid to each hole µ l. Terminate the reaction (at this point, the blue color immediately turns yellow).8. Measurement: Zero the blank hole and sequentially measure the absorbance (OD value) of each hole at a wavelength of 450nm. The measurement should be conducted within 15 minutes after adding the termination solution.Calculation:Draw a standard curve on a coordinate paper with the concentration of the standard substance as the x-axis and the OD value as the y-axis. Based on the OD value of the sample, determine the corresponding concentration from the standard curve; Multiply it by the dilution factor; Alternatively, a linear regression equation can be used to calculate the standard curve using the concentration and OD value of the standard substance. The OD value of the sample can be substituted into the equation to calculate the sample concentration, which is then multiplied by the dilution factor to obtain the actual concentration of the sample.Notes:1. The kit should be balanced at room temperature for 15-30 minutes before use when taken out from the cold storage environment. If the enzyme coated plate is not used up after opening, the Flat noodles should be stored in a sealed bag.2. Concentrated detergent may precipitate crystals. When diluted, it can be heated in a water bath to aid in dissolution. Washing does not affect the results.3. A sampler should be used for each step of sample addition, and its accuracy should be regularly calibrated to avoid experimental errors. It is best to control the sample addition time within 5 minutes. If there are a large number of specimens, it is recommended to use a firing gun for sample addition.4. Please make a standard curve at the same time as each measurement, preferably with a re hole. If the content of the substance to be tested in the sample is too high (the OD value of the sample is greater than the OD value of the first well of the standard well), please dilute the sample diluent by a certain multiple (n times) before measurement. When calculating, please multiply the total dilution multiple (x n x 5).5. The sealing film is only for one-time use to avoid cross contamination.6. Please store the substrate in dark.7. Strictly follow the instructions and determine the test results based on the reading of the enzyme-linked immunosorbent assay (ELISA) reader8. All samples, washing liquids, and various waste should be treated as infectious substances.9. The components of this reagent with different batch numbers shall not be mixed.Detection range:two µ G/L-90 µ G/L... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionTakasago (R)-Ru Cymene Kit I comprises of ruthenium-based biphenyl phosphine cymene catalysts containing either BINAP and SEGPHOS®ligands. These highly reactive and selective catalysts are useful in a variety of asymmetric reactions, mainly asymmetric hydrogenation |