| Description | Product IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized stateProduct IntroductionAlamar Blue detection reagent provides a simple, rapid, reliable and safe method for cell proliferation and cytotoxicity detection, which is suitable for high-throughput detection experiments. The main component of the detection reagent is a redox indicator. In the oxidized state, it appears purple-blue and non-fluorescent, while in the reduced state, it turns into a reduction product with pink or red fluorescence, with an absorption peak of 530-560nm and an emission peak of 590nm.In the process of cell proliferation, the ratios of NADPH/NADP, FADH/FAD, FMNH/FMN and NADH/NAD in the cell increase and are in a reducing environment. The dye taken into the cell is reduced by these metabolic intermediates and cytochromes and then released outside the cell and dissolved in the culture medium, changing the culture medium from non-fluorescent indigo blue to fluorescent pink. Finally, use an ordinary spectrophotometer or fluorophotometer for detection, and the absorbance and fluorescence intensity are proportional to the number of active cells.Instructions1. Add 10µl of detection reagent to 100µl of cell suspension, and incubate in a cell incubator for 2-6 hours. The color of the medium changes from indigo blue to pink and you can proceed to the next step.2. It is recommended to use a fluorescence microplate reader for detection, the excitation light wavelength is between 530-560 nm, the emission light wavelength is 590 nm, and the relative fluorescence unit (RFU) is recorded.3. Draw a standard curve or cell growth curve: the ordinate (Y axis) is the relative fluorescence unit (RFU); the abscissa (X axis) is the cell number or time point or drug concentration.Precautions1. The appropriate density of cells can increase the detection sensitivity. For 96-well plates, we recommend seeding 100 microliters of cells per well. The cell concentration range is: 100-10,000/well for adherent cells, 2,000-50,000/well for suspension cells, and medium as a blank control. For 384-well plates, the cell concentration and seeding volume are both halved.2. The whole process should be aseptic operation, because microbial contaminants can also reduce the detection reagents and affect the experimental results.3. Pay attention to the concentration of inoculated cells and the incubation time after adding detection reagents. If the cell concentration is too high or the incubation time is too long, it will cause a secondary reduction reaction, resulting in colorlessness and disappearance of fluorescence.4. When incubating, avoid light.5. This product can use fluorescence or spectrophotometric detection, but the sensitivity of fluorescence is high, and the experimental error is small. Fluorescence detection is recommended... Read More | B665530 Component 50 T 200 T Storage B665530A Buffer RCL 125 mL 2×260 mL 2-8℃ B665530B Buffer GR 15 mL 50 mL RT B665530C Buffer GL 15 mL 50 mL RT B665530D Buffer GW1 (concentrate) 13 mL 52 mL RT B665530E Buffer GW2 (concentrate) 15 mL 50 mL RT B665530F Buffer GE 15 mL 60 mL RT B665530G B665530 Component 50 T 200 T Storage B665530A Buffer RCL 125 mL 2×260 mL 2-8℃ B665530B Buffer GR 15 mL 50 mL RT B665530C Buffer GL 15 mL 50 mL RT B665530D Buffer GW1 (concentrate) 13 mL 52 mL RT B665530E Buffer GW2 (concentrate) 15 mL 50 mL RT B665530F Buffer GE 15 mL 60 mL RT B665530G Proteinase K 1.25 mL 4×1.25 mL RT B665530H Spin Columns DM with Collection Tubes 50 sets 200 sets RTProduct IntroductionThis reagent kit is suitable for extracting total DNA, including genomic DNA, mitochondrial DNA, and viral DNA, from fresh or frozen whole blood (blood samples treated with anticoagulants such as citrate, EDTA, or heparin), plasma, serum, erythrocyte sedimentation rate brown layer, lymphocytes, cell-free body fluids, and other samples. This product can process 0.1-1 mL of whole blood with a maximum yield of 30% µ g. It can purify DNA with sizes ranging from 100 bp to 50 kb. The purified DNA has high yield and good quality, and can remove protein, pigment, lipid, and other inhibitory impurities to the maximum extent. It can be directly used for PCR, fluorescence quantitative PCR, enzyme digestion, and Southern Blot experiments.Self prepared reagent: anhydrous ethanol.Preparation and important precautions before the experiment:1. The sample should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2. This reagent kit can extract up to 0.1-1 mL of whole blood samples or 1 × 107 white blood cells.3.Before the first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in the Buffer GL. If there is any crystallization or precipitation, please incubate the Buffer GL in a 56 ℃ water bath and dissolve it again.5. The Buffer RCL in the reagent kit cannot be used again after being turbid.Operation steps:1. Sample processing: 1a When extracting 200 uL of blood sample, add the sample to the centrifuge tube (provided) and proceed directly to the next step of the experiment. 1b When the blood sample size is less than 200 µ When L, add Buffer GR to make up for 200 µ L. Proceed to the next step of the experiment. 1c When the blood sample size exceeds 200 µ When L is reached, add 1-2 times the volume of Buffer RCL, gently vortex or invert and mix well. Centrifuge at 12000 rpm (~13400 × g) for 1 minute and carefully discard the supernatant. If there is still red in the sediment, repeat the above steps once. Then add 200 to the precipitate µ Shake the buffer GR until thoroughly mixed before proceeding to the next step of the experiment. 1d If the processed blood sample is anticoagulant from poultry, birds, amphibians, or lower level organisms, its red blood cells are nucleated cells, and the blood sample size is 5-20 µ L. Can be added to Buffer GR to make up to 200 µ Follow up experiments will be conducted afterwards. Note: If downstream experiments are sensitive to RNA, 4 can be added µ L RNase A (100mg/mL) solution, shake for 15 seconds, and leave at room temperature for 5 minutes. RNase A reagent kit is not provided. If needed, you can order it separately from our company, item number: CW0601S.2. Add 20 to the above solution µ L Protein K, mix well.3. Add 200 µ Shake with L Buffer GL until thoroughly mixed. Note: Do not pre mix Protein K and Buffer GL.4.Incubate at 4.56 ℃ for 10 minutes, invert and mix several times during this time. Attention: The DNA production has reached its maximum after 10 minutes of incubation, and further extension of incubation time has no effect on DNA production and purity.5. Add 200 µ L anhydrous ethanol, invert and mix several times. Short centrifugation causes the liquid on the tube wall and wall cover to concentrate at the bottom of the tube.6. Add all the solution obtained in step 5 to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Note: If the extracted sample is the blood genome of species such as mice or monkeys that are difficult to remove heme, it is recommended to repeat step 7.8. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Note: To further improve DNA purity, repeat step 8.9.Centrifuge at 9.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.)10. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃. Note: 1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high. 2) If the final concentration of DNA needs to be increased, the obtained DNA eluent can be added back to the adsorption membrane, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute. 3) Because DNA stored in water is affected by acidic hydrolysis, if long-term storage is required, it is recommended to elute with Buffer GE and store at -20 ℃... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | G665573 Component 10 T Storage G665573A Buffer P1 30 mL RT G665573B Buffer P2 30 mL RT G665573C Buffer E3 30 mL RT G665573D Buffer PS 15 mL RT G665573E Buffer PW (concentrate) 10 mL RT G665573F Endo-Free Buffer EB 30 mL RT G665573G RNase A (10 mg/mL) 600 碌L RT G665573H Endo-Remover FX 10 EA G665573 Component 10 T Storage G665573A Buffer P1 30 mL RT G665573B Buffer P2 30 mL RT G665573C Buffer E3 30 mL RT G665573D Buffer PS 15 mL RT G665573E Buffer PW (concentrate) 10 mL RT G665573F Endo-Free Buffer EB 30 mL RT G665573G RNase A (10 mg/mL) 600 碌L RT G665573H Endo-Remover FX 10 EA RT G665573I Plungers 10 EA RT G665573J Spin Columns DX with Collection Tubes 10 EA RT G665573K Centrifuge Tubes (15 mL) 10 EA RTProduct IntroductionThis kit is specially designed for the efficient and rapid extraction of plasmids from 15-50 ml of bacterial fluids. On the basis of cell lysis by alkaline lysis method, it adopts unique silicon matrix membrane adsorption technology to bind plasmid DNA efficiently and exclusively, and each adsorption column can adsorb up to 250 µg of plasmid DNA; at the same time, it adopts a special buffer system and endotoxin removal filter to effectively remove endotoxin, genomic DNA, RNA, protein and other impurities. The plasmids obtained from this kit are of high purity and stable quality, and can be used for cell transfection, as well as DNA sequencing, PCR, in vitro transcription, endonuclease digestion and other experiments.Self-contained reagents: anhydrous ethanol, isopropanol.Pre-experiment Preparation and Important Notes1. All components are stable for 1 year in a dry, room temperature (15-30°C) environment, and longer by placing the adsorption columns at 2-8°C. Buffer P1 with RNase A is stable for 6 months at 2-8°C.2. Before the first use, add all of the RNase A solution to Buffer P1, mix well, and store at 2-8°C. Before use, it needs to be left at room temperature for a period of time, return to room temperature and then use.3. Anhydrous ethanol should be added to Buffer PW before the first use according to the instructions on the reagent bottle label.4. Please check Buffer P2 and Buffer E3 for crystallization or precipitation before use. If there is any crystallization or precipitation, the clarification can be restored by taking a water bath at 37℃ for a few minutes.5. Be careful not to touch Buffer P2 and Buffer E3 directly, and tighten the lid immediately after use.6. The amount and purity of extracted plasmid is related to the concentration of bacterial culture, strain type, plasmid size, plasmid copy number and other factors.7. The adsorption columns treated with Buffer PS should be used immediately to avoid leaving them for too long.Operation steps1.Take 15-50 ml of fresh bacterial solution from the overnight culture, add it to a centrifuge tube (self-prepared) and centrifuge at 5000 × g for 10 minutes to collect the bacteria, and aspirate all the supernatant as much as possible.2.Add 2.5 ml of Buffer P1 to the centrifuge tube in which the bacterial precipitate has been left (please check that RNase A has been added first) and suspend the bacterial precipitate by mixing thoroughly using a pipette or vortex shaker. Note: If the bacterial mass is not thoroughly mixed, it will affect the lysis effect and make the extraction amount and purity low.3.Add 2.5 ml of Buffer P2 to the centrifuge tube, mix gently up and down 8-10 times to fully lyse the organisms, and leave at room temperature for 3-5 minutes. At this point the solution should become clear and viscous. Note: Mix gently, do not shake vigorously, so as not to interrupt the genomic DNA and cause genomic DNA fragments to be mixed in the extracted plasmid. If the solution does not become clear, it suggests that the amount of bacteria may be too large and the lysis is not complete, and the amount of bacteria should be reduced.4.Add 2.5 ml of Buffer E3 to the centrifuge tube and mix immediately by turning up and down 8-10 times, at which time a white flocculent precipitate appears. Note: Buffer E3 should be mixed immediately after addition to avoid localized precipitation.5.Install the cap of the filter (Endo-Remover FX), transfer the solution obtained in step 4 to the filter, wait until the white flocculent precipitate floats on the upper layer of the solution, remove the cap of the filter, align the filter with a clean 15 ml centrifuge tube (supplied), and slowly push the handle (Plungers) to filter, so that as much as possible of the solution passes through, and the filtrate is collected in the centrifuge tube.6.Add 1/3 solution volume of isopropanol to the filtrate and mix upside down.7.Column Equilibrium: Add 1ml Buffer PS to the adsorption column (Spin Columns DX) that has been loaded into a 15ml centrifuge tube, centrifuge for 2 minutes at 2500 x g. Pour off the waste liquid from the centrifuge tube and put the adsorption column back into the centrifuge tube.8.The mixture of filtrate and isopropanol from step 6 was transferred to the equilibrated adsorption column (which had been loaded into a collection tube).9.Centrifuge at 2500 x g for 1 minute, pour off the waste solution in the collection tube and put the adsorption column back into the collection tube. Note: The maximum volume of the adsorption column is 4 ml, so the solution obtained in step 8 is passed through the column in 2 times.10.Add 2 ml of Buffer PW to the adsorption column (please check that anhydrous ethanol has been added first), centrifuge at 2500 × g for 1 min, and pour off the waste liquid in the collection tube.11.Repeat step 10.12.The adsorbent column was put back into the collection tube and centrifuged at 2500 × g for 2 min, the waste liquid was poured off, and the column was left to dry at room temperature for 5 min.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with subsequent enzymatic reactions (digestion, PCR, etc.)13. Place the adsorption column in a new 15 ml centrifuge tube, add 0.5-1 ml Endo-Free Buffer EB to the middle of the adsorbent membrane, leave it at room temperature for 2-5 minutes, centrifuge it at 2500 × g for 2 minutes, and collect the plasmid solution into the centrifuge tube. -20°C to store the plasmid.Note: 1) In order to increase the recovery efficiency of the plasmid, the obtained solution can be reintroduced into the adsorption column, left at room temperature for 2-5 minutes, centrifuged at 2500 x g for 2 minutes, and the plasmid solution can be collected into a centrifuge tube.2) When the plasmid copy number is low or >10kb, Endo-Free Buffer EB can increase the extraction efficiency by preheating at 65-70°C in a water bath... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |