| Description | DescriptionUse in combination with the KitAlysis Bench Top Inertion Box (Z742064) or a glove box/glove bag to provide inert atmosphere for kit set-up.Designed to be used with KitAlysis High-Throughput Screening Kits.Components:24-Well Reaction BlockTorque ScrewdriverSmall screwdriver to easily DescriptionUse in combination with the KitAlysis Bench Top Inertion Box (Z742064) or a glove box/glove bag to provide inert atmosphere for kit set-up.Designed to be used with KitAlysis High-Throughput Screening Kits.Components:24-Well Reaction BlockTorque ScrewdriverSmall screwdriver to easily remove torqued screws after reaction is complete.10 Reaction Block Replacement Screws... Read More | Live & deadtm animal cell viability / toxicity detection kit (calcein am, ethd-i) is a kit that provides double fluorescent staining for the detection of animal cell death and survival. The two probes in the kit can respectively measure the activity of cellular lactonase and the integrity of Live & deadtm animal cell viability / toxicity detection kit (calcein am, ethd-i) is a kit that provides double fluorescent staining for the detection of animal cell death and survival. The two probes in the kit can respectively measure the activity of cellular lactonase and the integrity of plasma membrane to reflect cell viability. The kit can be used for fluorescence microscopy, flow cytometry, microplate reader and other fluorescence detection systems. This kit can be applied to most eukarYOtic mammalian cells, including some tissues with adherent nuclei, but it is not applicable to fungi and yeast. Compared with trypan blue, the kit is faster, safer and more sensitive.Component： Product parameters：Calcein am: ex/em = 494 / 517 nm; Ethd-i: ex/em = 528 / 617 nm (bound DNA)Usage:Fluorescence microscopy detection1. Prepare working fluidPreparation 2 µ M Calcein AM and 4 µ M EthD-I staining solution: Remove the original solution of Calcein AM and EthD-I and restore them to room temperature. Add 20 µ L 2 mM EthD-I and 5 µ Mix 4 mM Calcein AM with 10 mL PBS or other serum-free buffer or culture medium, vortex well. The above working solution can be directly used for cell staining.Note: The aqueous solution of Calcein AM is easily hydrolyzed and should be used up every day. The concentration selection of Calcein AM and EthD-I varies depending on the type of cell used, with a recommended concentration range of 0.1-10 µ M.2. Prepare cells and conduct experiments(1) For adherent cells, they can be washed 2-3 times with 1 × PBS before staining. For suspended cells, centrifuge at room temperature of 250-1000 × g for 5 minutes and collect cells for staining.(2) Wash the cells thoroughly 2-3 times with 1 × PBS to remove residual esterase activity.(3) For adherent cells, add sufficient amount of Calcein AM/EthD-I staining solution. For suspended cells, add an appropriate amount of staining solution to control the cell density between 1-5 × 105/mL.(4) Incubate at room temperature in dark for 15-20 minutes (if the working solution concentration is high or the incubation temperature is high, the incubation time should be appropriately reduced).(5) Observe the labeled cells under a fluorescence microscope.Flow cytometry detection1. Remove the reagent and restore it to room temperature.2. Preparation 2 µ M Calcein AM and 4 µ M EthD-I staining solution: Take out the original solution of Calcein AM and EthD-I, and restore to room temperature. Add 20 µ L 2 mMEthD-I and 5 µ Vortex mix 4 mM Calcein AM with 10 mL PBS or other serum-free buffer or culture medium. The working fluid can directly stain cells.3. Wash cells thoroughly 2-3 times with 1 × PBS.4. Suspend cells with 0.5 mL of staining solution and control the cell density to 1-5 × 105/mL.Note: It is recommended to prepare two additional cell samples, each containing only one dye (Calcein AM and EthD-I), for compensatory regulation of flow cytometry single staining; Prepare another cell sample containing only buffer solution (which should be consistent with the buffer used to prepare Calcein AM and EthD-I detection working solutions) as a negative control for flow cytometry analysis.5. Incubate at room temperature in dark for 15-20 minutes.6. Within 1-2 hours, cell activity was detected by flow cytometry. Calcein AM can be excited by a 488 nm laser, with fluorescence emission spectra detected at around 530 nm and EthD-I emission spectra at around 610 nm.Note: When using the cell circle gate, attention should be paid to excluding cell debris and using a single staining tube to regulate compensation. Double staining tube flow cytometry should obtain two relatively independent cell populations: a live cell population displaying green fluorescence and a dead cell population displaying red fluorescence.ELISA reader detection1. Cultivate an appropriate amount of adherent or suspended cells in a 96 well black ELISA plate.Note: Dead cells can be obtained by treating cells with 1% saponin or 0.1-0.5% digitalis saponin for 10 minutes.2. Preparation 2 µ M Calcein AM and 4 µ M EthD-I staining solution:Remove the original solutions of Calcein AM and EthD-I and restore them to room temperature. Add 20 µ L 2 mM EthD-I and 5 µ Mix 4 mM Calcein AM 10 mL PBS or other serum-free buffer or culture medium, vortex well.Note: (1) 10 mL of staining solution is sufficient to stain a 96 well plate, and the volume of the staining solution can be adjusted according to experimental needs. The concentrations of Calcein AM and EthD-I can range from 0.1 to 10 µ Explore between M.(2) The aqueous solution of Calcein AM is easily hydrolyzed and should be used up every day. EthD-I working solution can be stored at -20 ℃ for at least one year.3. Wash the cells thoroughly with 1 × PBS to remove residual esterase activity. For adherent cells, add 100 to each well µ Wash cells with PBS. For suspended cells, add 100 µ Resuspend cells with L PBS and centrifuge to remove the supernatant. Repeat the above operation.4. Add 100 to each hole µ L PBS.5. Add 100 to each hole µ L staining solution, making the total volume of each well 200 µ L. The final concentration of Calcein AM is 1 µ M. The final concentration of EthD-I is 2 µ M. Gently shake the culture plate to evenly cover the cells with the liquid.Incubate at room temperature in dark for 30-45 minutes.Note: The optimal incubation time varies for different cells, with 30 minutes as the initial incubation time. Subsequently, the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect.7. Enzyme reader detection. When the ELISA reader is set to fluorescein, it can detect Calcein AM; When the ELISA reader is set to rhodamine or Texas Red, EthD-I can be detected. Select the optimal emission and excitation wavelengths based on spectral characteristics.Note: By comparing the relative fluorescence values (RFU) measured between the sample group and the control group, the changes in the number of dead and live cells can be obtained. Another method of data analysis is also provided below.The following method can calculate the ratio of live cells to dead cells in a certain region. The required samples include dead cell control group, live cell control group, and the sample group to be tested. Dead cells can be obtained by treating cells with 1% saponin or 0.1-0.5% digitalis saponin for 10 minutes.1. Prepare staining solution and follow the above steps to stain cells. Additionally, prepare 1 mL and 2 mL separately µ M Calcein AM and 4 µ M EthD-I solution, stain the control group according to the following instructions. For the following groups of cells or cell-free groups, it is necessary to maintain complete consistency in cell count, detection of working solution concentration, incubation time, and incubation temperature.2. Measurement of sample group and control group:A. The measured values of the sample group at 645 nm are denoted as Calcein AM and EthD-I=F (645) sam.B. The measured values of the sample group at 530 nm are denoted as Calcein AM and EthD-I=F (530) sam.C. The measurement value of dead cell EthD-I single staining control group at 645 nm is denoted as EthD-I=F (645) maxD. The measurement value of dead cell Calcein AM single staining control group at 645 nm is recorded as Calcein AM=F (645) minE. The measurement value of live cell EthD-I single staining control group at 530 nm is recorded as EthD-I=F (530) min.F. The measurement value of live cell Calcein AM single staining control group at 530 nm is denoted as Calcein AM=F (530) max.G. A blank control well without cells (with or without dye), the detection value at 530 nm is recorded as F (530) 0.H. A blank control well without cells (with or without dye), the detection value at 645 nm is recorded as F (645) 0.3. Calculate the ratio of dead cells to live cells based on measurement data:%Live Cells=(B-E) ÷ (F-E)%Dead Cells=(A-D) ÷ (C-D)Determine the ratio of live cells to dead cells in a certain areaBy creating fluorescence spectral standard curves at 530 nm and 645 nm, the number of dead and live cells can be determined, and the fluorescence intensity of each dye is linearly related to the number of dead or live cells in the sample.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. phenol red or serum may interfere with the detection of this kit. 3. fluorescent dyes have quenching problems. Please try to avoid light during experimental operation to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Dead and live cell staining (animal)... Read More | N665917 Component 1 mL 5 mL Storage N665917A 2×SYBR qPCR MasterMix 1 mL 5×1 mL -20℃. Avoid freeze/ Thaw cycle. N665917B qPCR Primer Mix 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917C DNA Standard A 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917 Component 1 mL 5 mL Storage N665917A 2×SYBR qPCR MasterMix 1 mL 5×1 mL -20℃. Avoid freeze/ Thaw cycle. N665917B qPCR Primer Mix 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917C DNA Standard A 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917D DNA Standard B 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917E DNA Standard C 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917F DNA Standard D 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917G DNA Standard E 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665917H 50×High ROX 40 µL 200 µL -20℃. Avoid freeze/ Thaw cycle.Product IntroductionThis is a dye-based (SYBR Green I) qPCR NGS library quantification kit for cfDNA, which provides the reaction mixture, DNA primer mixture, standards, and sample dilutions required for the qPCR process, making it a complete reagent system that is easy and convenient to use. The fluorescent dye SYBR Green I contained in the reaction mixture binds to all double-stranded DNA. The kit uses a new chemically modified high-efficiency hot-start polymerase, the activation of the enzyme needs to be incubated at 95 ℃ for 10 min. the product is highly specific, high amplification efficiency, the length of the standard in the kit (about 270bp) is comparable to the average length of the cfDNA NGS libraries (250-300bp), which is able to quickly and accurately quantitate the concentration of the constructed cfDNA libraries. quantification.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument.Instruments that do not require ROX calibration: Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96, etc.Instruments requiring Low ROX calibration: ABI Prism7500/7500 Fast, QuantStudio®3 System, QuantStudio®5 System, QuantStudio®6 Flex System, QuantStudio®7 Flex System, ViiA7 System, Stratagene Mx3000/Mx3005P, Corbett Rotor Gene 3000, and others.Instruments requiring High ROX calibration: ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, etc.NOTE: High Rox and Low Rox are formulated as described in Method of Use 2.Applicable scopeThis product is designed for the absolute quantification of the concentration of Illumina platform second generation sequencing libraries. The end of the library contains Illumina P5 and P7 microarray binding sequences, the length of which does not exceed 1kb, and the concentration is not less than 0.02pM can be used for quantitative experiments. The qPCR Primer Mix provided in the kit contains the following two primer sequences:Primer 1:5'-AAT GAT ACG GCG ACC ACC GA-3' Primer 2: 5'-CAA GCA GAA GAC GGC ATA CGA-3'The primer sequence can be used in advance to confirm whether the library can be amplified by that primer pair.UsageAmplification template preparationThe library samples to be detected were diluted with TE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA), and the concentration after dilution was as close as possible to the range of 0.01-60 pM. 4°C on ice was set aside.qPCR reaction system preparationThe desired cryopreservation reagent is pre-melted completely and mixed by inverting several times before preparation, then centrifuged briefly and set aside.The base reaction system for 20 µl was as follows:Reagent20 µl Reaction system2×SYBR qPCR MasterMix10 µlqPCR Primer Mix0.8 µlTemplate4 µlddH₂O5.2 µlDescription: High Rox model: 1 µl High Rox per 50 µl of reaction system; Low Rox model: 1 µl High Rox per 500 µl of reaction system.Prepare a sufficient amount of reaction system mixture according to the need, mix well and add to the reaction wells in a volume of 16 µl per well, add the same volume of TE to the blank control, and then add the prepared standards and diluted samples to the corresponding reaction wells in a volume of 4 µl/well. It is recommended to use 20 µl reaction system, if you need to carry out a smaller system reaction, the system components can be reduced in equal proportion.3.qPCR reaction programIf the average length of the library is greater than 700bp, the annealing/extension time should be increased appropriately.Refer to the specific instrument setup program for dissolution curves.data analysisStandard curve productionThe standard curve was plotted according to the data processing Excel sheet. The correlation coefficient R2 of the standard curve should be not less than 0.99, and the slope should be located between -3.1 and -3.6 when the Ct value is the longitudinal coordinate. If the parameters of the standard curve are unreasonable, it is recommended to repeat the experiment.DNA Standard NameDNA Standard ConcentrationDNA Standard A60 pMDNA Standard B6 pMDNA Standard C0.6 pMDNA Standard D0.06 pMDNA Standard E0.006 pMLibrary Concentration CalculationsThe difference in Ct between the three replicate wells of the experiment should be no more than 0.2, otherwise the invalid data should be deleted or the experiment should be repeated. Do not use the Ct outside the valid Ct range of the standard curve to calculate the concentration of the diluted libraries. Please refer to the data processing Excel of this product for the specific library concentration calculation method.matters needing attentionThese instructions should be read in detail before testing. It should be carried out by personnel with specialized experience or qualified by training.Mix gently by turning up and down, avoid foaming as much as possible, and centrifuge for a short time before use.Avoid repeated freezing and thawing of this product; repeated freezing and thawing may degrade product performance.When preparing reaction solutions, use new or non-contaminated tips and centrifuge tubes to prevent contamination as much as possible... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The fluorescent dye PKH67 is suitable for conventional cell membrane labeling. It is a green fluorescent dye that can track cells in vitro and in vivo. It labels cells by binding to the lipid components of the membrane structure. PKH67 has low cytotoxicity, low fluorescence background, high fat The fluorescent dye PKH67 is suitable for conventional cell membrane labeling. It is a green fluorescent dye that can track cells in vitro and in vivo. It labels cells by binding to the lipid components of the membrane structure. PKH67 has low cytotoxicity, low fluorescence background, high fat solubility, can easily penetrate cell membranes, and has strong and stable green fluorescence. PKH67-labeled cells can be used for in vitro and in vivo proliferation studies, and have the function of not staining neighboring cells. In the process of cell division and proliferation, the fluorescence intensity of PKH67 will gradually decrease as the cells divide. The labeled fluorescence can be evenly distributed to the two sub-generation cells, so its fluorescence intensity is half that of the parent cell. According to this feature, It can be used to detect cell proliferation, cell cycle estimation and cell division, etc. The fluorescence of PKH67-labeled cells is very uniform, and the fluorescence distribution of sub-generation cells after division is also more uniform. In the process of cell division and proliferation, PKH67-labeled fluorescence can be evenly distributed between the two sub-generation cells, and the fluorescence intensity becomes half of that of the parent cell. According to the difference in fluorescence intensity, the undivided cells can be detected by flow cytometry. One time (1/2 the fluorescence intensity), the second time (1/4 the fluorescence intensity), three times (1/8 the fluorescence intensity), and more divisions of cells. PKH67 can detect splits up to six times or even more. In addition to the detection of cell proliferation, PKH67 can also be used for in vitro tracking of cells. After labeling, the fluorescence expression is stable in the cell, and the positive labeling rate is over 98%. The labeled cells have good morphology, which can effectively observe the cells in vitro. Induce differentiation; or inject labeled cells into the body, it can effectively show the migration and differentiation of transplanted cells in living tissues. PKH67-labeled cells can be used for in vivo observation for as long as several weeks. It is often used for in vivo cell detection experiments and experiments to observe long-term cell activity using fluorescence electron microscope. PKH67 is less toxic and does not affect cell proliferation. This method is simple to operate, does not use radioactive isotopes, and poses no safety hazards. You can get the desired experimental data faster, more accurately and more safely.Due to the longer length of the charcoal tail, internal studies have shown that PKH67 is less transferred between cells than PKH2. In in vivo studies using PKH1 and PKH2, the fluorescence intensity will slowly lose. Since this is a behavioral characteristic of green cell linker dye rather than red cell linker dye, PKH67 will have similar properties. The correlation between the in vitro cell membrane retention of non-dividing cells and the in vivo fluorescence half-life reveals that the in vivo fluorescence half-life of PKH67 is 10-12 days. Other green cell linker dyes with similar half-lives have been used to monitor the transport of lymphocytes and macrophages in the body within one to two months. The results indicate that PKH67 can also be used for medium-term in vivo tracking studies.The dye can stably bind to the lipid region of the cell membrane and emit fluorescence, and is mainly used for cell labeling in vitro, cell proliferation research in vitro, and cell tracing research in vivo and in vitro. The fluorescence half-life of PKH67 in vivo is 10-12 days. Compared with PKH-67, PKH-26 has a longer half-life, and the half-life of PKH26 labeled on rabbit red blood cells is more than 100 days. Especially suitable for in vitro proliferation research and long-term in vivo cell tracking research. After PKH67 labels the cells, flow cytometry is usually used for cell proliferation detection.Kit components0.1ml kits: P266290A-0.1ml P266290B-10ml1ml kits: P266290A-1ml P266290B-60mlDyes with A suffix and diluents with B suffix are used togetherPKH67 labeled cells show green fluorescence, the fluorescence wavelength: λex=490 nm, λem=502 nm.Storage conditions: -20℃ protected from light, valid for 1 yearPrecautions●Staining concentration varies according to the type of cell and the number of cells in each well.● The prepared PKH67 mother liquor is very easy to dissolve. It is recommended to store in aliquots and freeze-dry at ≦-20℃.● PKH67 working solution should be prepared for immediate use, and cannot be prepared in advance, because PKH67 will decompose due to the absorption of water and affect the dyeing effect.● PKH67 is easily decomposed and will deteriorate quickly in the water solution. Please avoid contact with water during use of mother liquor. The working fluid is in contact with the water during the process of labeling the cells within the permitted time range.● PKH67 fluorescent dye is a DMSO solution. It will solidify and stick to the bottom, wall or cap of the tube at a lower temperature such as 4℃ and ice bath. After being taken out of the refrigerator, it will return to room temperature and become After the liquid is in the state, remove the cap from the bottom of the tube. It can be used after it has completely melted in a 37°C water bath.● The number of generations or time that can be traced after different cell types are marked is quite different. Please make a test based on the actual situation or reference documents.Instructions1. Staining solution preparation:(1) Take out the PKH67 reagent from the refrigerator, let it stand for a few minutes to room temperature, or after a 37°C water bath, leave the tube containing PKH67, and be sure to leave the tube for a few minutes before opening the lid to allow the reagent to fully fall into the tube The lid can only be opened after the bottom.(2) According to the number of cell samples to be tested, dilute the probe 10 times with the diluent, and then use a suitable solution (such as non-clear medium, HBSS or PBS) to dilute the PKH67 mother liquor 25 times to prepare a stain Work fluid. The best working solution concentration should be adjusted according to different cells and your own experimental system. Generally, the cells can be diluted 250 times according to the final concentration of the mother liquor in the kit. Some cells may need to increase the concentration appropriately.2. Cell staining(1) Resuspend the prepared cells to be tested in 100µl of staining solution to a cell concentration of about 107/ml. You can also perform in-situ staining, as long as the staining solution is enough to cover the cells.(2) Culture the cells at 2～8℃ for 15～30 minutes. The best culture time is different for different cells.It is recommended to incubate the labeled cells in the staining solution at 37°C for 5 minutes, and then at 4°C for 15 minutes.Low-temperature incubation can reduce the endocytosis of the dye by the cells, help the dye to label the plasma membrane, and reduce the possibility of the dye localizing to cytoplasmic vesicles.(3) After separation, remove the supernatant, collect the cells, wash the cells 1-2 times with PBS or non-clear medium, and finally add PBS or non-clear medium to resuspend the cells.(4) Take 500µl of cell suspension and test with flow cytometer. Ex/Em=490/502nm.(5) Subsequently, the cells can be cultured according to the normal culture method.(6) The labeling effect can be directly observed under a fluorescence microscope, or the cell proliferation can be detected by a flow cytometer after an appropriate period of culture, or used for cell fluorescence traces for other specific experimental purposes... Read More |