| Description | Format:2-ComponentEnzyme:Horseradish peroxidase | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | N665925 Component 1 mL 5 mL Storage N665925A 2×SYBR qPCR Master Mix 1 1 mL 5 mL -20℃. Avoid freeze/ Thaw cycle. N665925B qPCR Primer Mix 1 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925C DNA Standard I 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925 Component 1 mL 5 mL Storage N665925A 2×SYBR qPCR Master Mix 1 1 mL 5 mL -20℃. Avoid freeze/ Thaw cycle. N665925B qPCR Primer Mix 1 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925C DNA Standard I 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925D DNA Standard II 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925E DNA Standard III 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925F DNA Standard IV 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925G DNA Standard V 100 µL 500 µL -20℃. Avoid freeze/ Thaw cycle. N665925H 50×High ROX 40 µL 200 µL -20℃. Avoid freeze/ Thaw cycle.Product IntroductionThis product is a real-time fluorescence quantitative PCR of the products after NGS library construction using a dye method (SYBR Green I).(qPCR). The kit provides the reaction mixes, DNA primer mixtures, standards and sample dilutions required for the qPCR process, making the reagent system complete and easy to use. The fluorescent dye SYBR Green I contained in the reaction mixture can bind to all double-stranded DNA; the GoldStar Taq DNA Polymerase used is a chemically modified new high-efficiency hot-start polymerase, and the activation of the enzyme needs to be incubated at 95℃ for 10 minutes. the product has high specificity, high amplification efficiency, and is able to quickly and accurately quantify the concentration of the constructed libraries. The product is highly specific and efficient in amplification, and can quickly and accurately quantify the concentration of the constructed library.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument.Instruments that do not require ROX calibration: Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96, etc.Instruments requiring Low ROX calibration: ABI Prism7500/7500 Fast, QuantStudio®3 System, QuantStudio®5 System, QuantStudio®6 Flex System, QuantStudio®7 Flex System, ViiA 7 System, Stratagene Mx3000/Mx3005P, Corbett Rotor Gene 3000, and others.Instruments requiring High ROX calibration: ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, etc.Note: High Rox and Low Rox are formulated as described in Use 2.Scope of applicationThis product is designed for absolute quantification of the concentration of Ion torrent platform second generation sequencing libraries. The end of the library contains Ion torrent P5 and P7 microarray binding sequences, the length of which does not exceed 1kb, and the concentration is not less than 0.005pM can be used to perform quantitative experiments with this product. The qPCR Primer Mix provided in the kit contains the following two primer sequences:Primer 1:5'-CCA TCT CAT CCC TGC GTG TC - 3' Primer 2: 5'-CCT CTC TAT GGG CAG TCG GTG AT-3'The primer sequence can be used in advance to confirm whether the library can be amplified by that primer pair.Usage1. Amplification template preparationThe library samples to be detected were diluted with TE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA), and the concentration after dilution was as close as possible to the range of 0.05-50 pM. 4°C on ice was set aside.2. qPCR reaction system preparationThe desired cryopreservation reagent is pre-melted completely and mixed by inverting several times before preparation, then centrifuged briefly and set aside.The base reaction system for 20 µl was as follows:Reagent20 µl Reaction system2×SYBR qPCR MasterMix10 µlqPCR Primer Mix 10.8 µlTemplate4 µlddH₂O5.2 µlDescription: High Rox model: add 1 µl High Rox per 50 µl of reaction system;Low Rox model: 1 µl High Rox per 500 µl of reaction system.Prepare a sufficient amount of reaction system mixture according to the need, mix well and add to the reaction wells in a volume of 16 µl per well, add the same volume of TE to the blank control, and then add the prepared standards and diluted samples to the corresponding reaction wells in a volume of 4 µl/well. It is recommended to use 20 µl reaction system, if you need to carry out a smaller system reaction, the system components can be reduced in equal proportion.3. qPCR reaction program1) Please use 60-64℃ as a reference for setting range of annealing temperature, and increase the annealing temperature when non-specific reaction occurs.2) If the average length of the library is greater than 700bp, the annealing/extension time should be increased appropriately.data analysis1. Standard curve productionThe standard curve was plotted using Ct values in the valid range. The standard curve correlation coefficient R2 should not be less than 0.99 and the slope should lie between -3.1 and -3.6. If the standard curve parameters are not reasonable, it is recommended to repeat the experiment.DNA Standard NameDNA Standard ConcentrationDNA Standard I50 pMDNA Standard II5 pMDNA Standard III0.5 pMDNA Standard IV0.05 pMDNA Standard V0.005 pM2. Library concentration calculationThe difference in Ct between the three replicate wells of the experiment should be no more than 0.2, otherwise the invalid data should be deleted or the experiment should be repeated. Do not use the Ct outside the valid Ct range of the standard curve to calculate the concentration of the diluted libraries. Please refer to the data processing Excel of this product for the specific library concentration calculation method.matters needing attention1. Before testing, these instructions should be read in detail. It should be operated by personnel with professional experience or qualified by training.2. For use, please mix gently by turning up and down, avoid foaming as much as possible, and use it after centrifugation for a short period of time.3. Avoid repeated freezing and thawing of the product, repeated freezing and thawing may degrade the performance of the product.4. When preparing the reaction solution, please use new or non-contaminated tips and centrifuge tubes to prevent contamination as much as possible... Read More | Inquire | Inquire |