| Description | Inquire | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Apoptosis refers to the cell autonomous and orderly death controlled by genes to maintain the stability of the internal environment. Apoptosis is different from cell necrosis. Apoptosis generally refers to a programmed cell death process that occurs during the development of body cells or under the Apoptosis refers to the cell autonomous and orderly death controlled by genes to maintain the stability of the internal environment. Apoptosis is different from cell necrosis. Apoptosis generally refers to a programmed cell death process that occurs during the development of body cells or under the action of some factors through the regulation of intracellular genes and their products. Cell necrosis is a cell death process that is caused by strong physical and chemical or biological factors to cause disordered changes in cells. The difference between apoptosis and necrosis lies in the characteristic morphological and biochemical changes, including the changes of cell membrane permeability and nuclear chromatin, the contraction of cytoplasm and the loss of membrane asymmetry. The oxazole yellow/pi membrane permeability apoptosis detection kit produced by our company is a dual fluorescence detection kit based on oxazole yellow and PI dyes. This kit is suitable for fluorescence microscopy, flow cytometry, fluorescence microplate reader and other fluorescence detection systems. Oxazole yellow is a non cell membrane penetrating cyanine monomer green fluorescent dye with high affinity for DNA. It basically has no fluorescence when it is not bound to DNA, but can emit bright green fluorescence after binding to DNA. When apoptosis occurs, the permeability of cell membrane changes. At this time, oxazole yellow can enter the cell and bind to DNA, emitting bright green fluorescence. Therefore, it is often used for the detection of apoptosis. It should be noted that oxazole yellow can also stain dead cells, so it needs to be double stained with PI that specifically fluorescently stains dead cells to effectively determine apoptosis. PI (propidium iodide) is a red fluorescent dye that can stain DNA. It is an analog of pyridine bromide that releases red fluorescence after embedding double stranded DNA. Although PI cannot pass through the membrane of living cells, it can cross the damaged cell membrane of dead cells to stain nuclei. Therefore, oxazole yellow combined with PI can be directly used for the detection of apoptosis. Apoptotic cells show green fluorescence, dead cells show both red and green fluorescence positive, and living cells have little or no fluorescence.Components: Components O598364-50T A. Oxazole yellow dye 50 µL B. Propidium Iodide (PI) 50 µLUsage (using flow cytometry as an example):1. Cell preparation(1) For adherent cells, after trypsin digestion, resuspend in culture medium and wash once with pre cooled PBS; The digestion time of trypsin should not be too long to prevent false positives. Note: Digest with trypsin and allow the cells to recover in the optimal cell culture conditions and medium for about 30 minutes, then stain.(2) For suspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and wash once with pre cooled PBS.2. Cell stainingSuspend cells in pre cooled PBS, with a recommended cell count of 106 cells/mL per sample. Add 1 µ L Oxazole Yellow and 1 µ L to 1 mL of the samplePI， Gently blow and mix well. Incubate on ice in the dark for 30 minutes. Note: We suggest adding the following two experimental controls:Blank tube: negative control group cells, without dye, used to regulate voltage.Single staining tube: Positive control group cells were treated with only two tubes, Oxazole yellow and PI, for regulating compensation.3. Flow detectionAfter incubation, the sample can be directly detected by flow cytometry, or centrifuged at 1000 rpm for 5 minutes, the supernatant can be aspirated, and the sample can be resuspended in 1 mL of pre cooled PBS for flow cytometry detection. Oxazole yellow can be excited by a 488 nm laser, and the detected fluorescence emission spectrum is around 530 ± 30 nm (FITC channel), while the PI channel emission spectrum is around 617 nm (PI or PE channel).Product parameters：Oxazole yellow dye:ex/em = 491 / 509 nm (bound DNA); Propidium iodine:ex/em = 535 / 617 nm (combined with DMatters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. fluorescent dyes have quenching problems. Please try to avoid light to slow down fluorescence quenching. 3. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Membrane permeability apoptosis assay... Read More | Product introduction：This kit uses an improved SDS alkaline lysis method combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of rapid purification of plasmid DNA. It is suitable for extracting up to 500ug of high-purity plasmid DNA from 120-300ml bacterial Product introduction：This kit uses an improved SDS alkaline lysis method combined with DNA preparation membrane to selectively adsorb DNA to achieve the purpose of rapid purification of plasmid DNA. It is suitable for extracting up to 500ug of high-purity plasmid DNA from 120-300ml bacterial culture for sequencing, in vitro transcription and translation, restriction enzyme digestion, bacterial transformation and other molecular biology experiments.Scope of application：Nucleic acid extraction and purification... Read More |