| Description | Inquire | Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize Product Characteristics Effect Diluents, Animal-free are effective buffers free of any animal components. They can be used for the dilution of serum, plasma, blood, stool or urine samples, as well as the dilution of primary and secondary antibodies. Effect Diluents, Animal-free efficiently minimize matrix effects, cross-reactions and unspecific binding in immunoassays like ELISA, Western blotting, Immunohistochemistry, protein arrays and immuno-PCR.The Effect Diluents, Animal-free are used alternatively to the standard sample or antibody dilution buffers: In ELISA for the dilution of specimen and detection antibodies. In Western Blotting for the dilution of primary and secondary antibodies. In Protein arrays for the dilution of specimen and detection antibodies. In immuno-PCR as a washing buffer.Three versions of the diluent are offered: Low, Medium and High for optimal discrimination between specific and unspecific reaction and for minimizing strong interference effects e.g., by RF (rheumatoid factors), HAMAs (human-a-mouse Abs) or by endogenous components that bind and mask the analyte.Composition & Properties The Effect Diluents, Animal free contain no animal components and are free of phosphates.Working Procedure 1.Mix thoroughly prior to use. 2.Dilution recommendations a.Dilute antibodies according to the instruction of the antibody b.Dilution of the specimen is recommended at 1:2 or higherTips & TricksEffect Diluents must not be considered as blocking buffers. Recommended blocking buffers are: Synthetic Blocking Buffer, ELISA (cat. no. S494401), Synthetic Blocking Buffer, Blotting (cat. no. S494457) and WellChampion (cat. no. W494467) for plate blocking and stabilization (preparation of pre-coated plates). Complex sample matrices, such as serum and plasma, may contain interfering factors that affect the ability of the assay to accurately quantify the target analyte. Strong interferences are often caused by RFs and HAMAs. This matrix effect can cause high background in the negative control or false negatives in the sample measurement. To reduce this effect the samples can be diluted in the Effect Diluents, Animalfree.Handling & Storage Store solution 2-8°C or -15 to -30°C (tolerates freezing and thawing cycles)... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire |