| Description | Inquire | Format:2-ComponentEnzyme:Horseradish peroxidase | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Inquire | Product introduction:PMA qPCR live bacteria detection kit provides an effective means to detect bacterial activity. This kit provides a mixture of PMA dye and SYBR green dye based qPCR. The optimal amount of dye and the number of samples that can be processed may vary depending on the type ofProduct introduction:PMA qPCR live bacteria detection kit provides an effective means to detect bacterial activity. This kit provides a mixture of PMA dye and SYBR green dye based qPCR. The optimal amount of dye and the number of samples that can be processed may vary depending on the type of sample. PMA is a DNA binding dye with high affinity, especially with double stranded DNA. The dye itself has weak fluorescence, but it can emit brighter fluorescence after binding with nucleic acids. PMA is impermeable to the cell membrane, so it can selectively modify the DNA of dead cells with damaged membrane. After bllight (~464 nm) photolysis of PMA modified DNA, the photoreactive azido group on PMA is converted into highly reactive azene radical, which reacts with any hydrocarbon moiety near the DNA binding site to form a stable covalent nitrogen carbon bond, resulting in permanent DNA modification. This modification process will make the DNA insoluble, and it will be lost together with cell debris in the later genomic DNA extraction process. The unbound PMA remaining in the solution reacts with water molecules under strong light irradiation and decomposes into hydroxylamine compounds without cross-linking activity, so that it can no longer covalently bind DNA. Based on this characteristic of PMA, our company combines PMA and qPCR technology to form a new detection method - PMA qPCR, which is used for the screening of live bacteria. At present, the method has been validated in a variety of bacterial strains as well as yeast, fungi, viruses and parasites. The treatment of complex samples, such as feces or soil, may require optimization of sample dilution, dye concentration, and light treatment time. Treatment of diluted samples, such as water testing, may require filtration or concentration prior to dye treatment. Component: Instruction: Precautions before use:1.This live bacteria detection kit distinguishes dead bacteria and live bacteria according to cell membrane permeability. Many methods of killing bacteria cause damage to the cell membrane and are therefore compatible with this kit. But some methods, such as ultraviolet irradiation, may not immediately cause cell membrane rupture. Therefore, before selecting this kit, it is necessary to carry out literature search and pre-experiment to determine whether the kit is suitable for the bacterial type and killing method you choose. 2.After PMA treatment, the bacteria need to be photolyzed to covalently bind the dye to dead cell DNA. Photolysis operations can use blue or white light sources. Generally speaking, the brighter the lamp, the higher the efficiency of the photolysis step. Non-LED lamps ( such as halogen lamps ) may heat your sample and have a negative impact on the analysis. Ice is required to cool the sample during irradiation. 3.Sample can be cryopreservation after photolysis. Frozen samples before PMA treatment photolysis may damage the cell membrane and produce false negative results. If the sample needs to be frozen before detection, it is recommended to perform a pre-experiment first. 4.Part of the mechanism of PMA is to remove PMA covalently modified DNA from the sample by precipitation ; therefore, when extracting genomic DNA, it is necessary to use the same volume of genomic DNA eluent for volume normalization. The positive control can use the genomic DNA of living cells. 5.In order to verify the effectiveness of PMA in the test sample, the Ct ( dCt ) changes between- / + PMA can be compared. Experimental materials ( self-provided ):①Light source ( used for the photolysis step after PMA modified DNA ) ;② Bacterial genomic DNA extraction kit ; Experimental procedure: 1.Suck 10 µL of E.coli bacterial solution in liquid LB medium, and culture E.coli in the bacterial incubator overnight or longer to the logarithmic growth phase ( OD600 ≈ 1.0 ) ; Note : The culture time is adjusted according to the experiment. 2.Two portions of live E.coli, 400 µL each, were placed in a clean centrifuge tube ; 3. ( Recommended ) Preparation of dead E.coli. If the dead E.coli is needed as a control, the dead E.coli can be obtained by heating the living E.coli in a water bath at 95 °C for 5 min, or at 58 °C for 3 h. the subsequent operation of the dead E. coli is the same as that of the living E. coli ; 4.Two copies of live E.coli, one without PMA treatment, and one with 25 µM PMA treatment ( the optimal PMA concentration for treating different types or different sources of bacteria needs to be consulted in the relevant literature ) ; 5.The PMA-treated samples were placed on a shaker at room temperature and incubated in the dark for 10 min to fully mix the dye with the sample ; 6.Exposure of the sample, you can use blue or white light source, irradiation time to explore their own. For example, a 60 W blue light can be used for 15 min. Note : 1 If a halogen lamp is used, we recommend that the PMA-treated sample tube be placed on an ice block 20 cm away from the light source. Ice should be placed in a transparent tray. Adjust the light source to point directly to the sample, photolysis for 5-15 min ; if the bacteria obtained from the environment are directly used for experiments, due to the complexity or turbidity of the environmental samples, the photolysis time needs to be prolonged appropriately. 7.Treated and untreated live E.coli 5000 × g, centrifuged for 10 min, remove the supernatant ; 8.Select the appropriate genomic DNA extraction kit according to the sample type, and use the same elution volume for each group of samples when elution DNA. Note : DNA extraction steps refer to the instructions of the kit used. Part of the mechanism of action of PMA is to remove PMA-bound DNA from the sample by precipitation ; therefore, when extracting genomic DNA, each group should use the same volume of genomic DNA eluent for volume normalization ( the amount of genomic DNA extracted from dead bacteria and live bacteria is inconsistent, so the concentration of the two is significantly different ). 9.Preparation of reaction mixture according to the following system : Note : 1 For the DNA extracted by commercial DNA extraction kit, the qPCR template was optimized with 2 µL as the initial volume ; 2 The template volume should not exceed 10 % of the final reaction volume ; 3 Template concentration : gDNA as template, usually 1-10 ng ; the final concentration of PCR primers is usually 0.4µM, which can get better results. When the reaction performance is poor, the primer concentration can be adjusted in the range of 0.2-1µM. 10.Slightly vortex the reaction mixture, transfer the fixed volume to the PCR tube. 11. Test procedureNote : 1 The extension time is adjusted according to the instrument ; the Taq enzyme in mix can be activated within 2 min, but the genomic DNA may require longer denaturation time, which can be increased at this time, and the specific denaturation time can be adjusted according to the sample type. 12. ( Optional ) Data analysis Using live bacteria and dead bacteria as controls, the number of live cells in the sample was analyzed and calculated. It is recommended to verify the suitability of primers and PCR procedures before starting PMA qPCR detection of live bacteria. Calculation of dead and living bacteria control dCt ( 1 ) After the end of qPCR, the Ct value of each sample was calculated by instrument software ; ( 2 ) By calculating the dCt of each control bacteria, it was judged whether PMA successfully inhibited the amplification of dead bacterial DNA. The calculation is as follows : dCt live = Ct ( live, PMA treated ) -Ct ( live, PMA untreated ) dCt die = Ct ( die, PMA treated ) -Ct ( die, PMA untreated ) ( 3 ) The dCt expectation of living bacteria is close to 0 ± 1, which indicates that PMA does not affect the amplification of living cell DNA ; ( 4 ) The expected value of dCt of dead bacteria is greater than 4 ( dCt is 4 means that it is reduced by about 16 times, that is, 94 % of dead bacterial DNA is removed ; a dCt of 8 indicated a decrease of about 250 times, that is, 99.6 % of the dead bacterial DNA was removed ).( 5 ) The dCt of dead bacteria depends on many factors, including : strain / cell type ; the way bacteria are killed ; the concentration of PMA used ; amplified sequence length. 3. Calculation of the proportion of viable ( optional ) bacteria If the control results of dead and live bacteria are normal, the proportion of live bacteria in the sample can be calculated.( 1 ) Calculate the dCt value of the sample : dCt sample = Ct ( sample, PMA treated ) -Ct ( sample, PMA untreated ) ( 2 ) Conversion of dCt value to live bacteria ratio : PMA inhibition multiple = 2 ( sample dCt ) Viable bacteria % = 100 / PMA inhibition multiple 14. ( Optional ) Calculate the absolute number of live bacteria If you want to calculate the absolute number of viable bacteria in the sample, you need to use a known number of target bacteria genomic DNA to make a standard curve. It is recommended that the diluted concentrations of several groups of genomes are within the range of the qPCR analysis system. ( 1 ) qPCR was performed with the appropriate genome, and the Ct value was used as the ordinate, and the number of cells was used as the abscissa. The R2 value is calculated to determine the linearity, and the slope and y-axis intercept are displayed.( 2 ) Calculate the copy number of the experimental samples : Ct = slope * cell number + y axis intercept ( y = mx + b ) Bacterial count sample = ( Ct-y axis intercept ) / slope Note : The live bacterial DNA was not lost during the purification process. Examples : Product parameters:Pma: ex = 464 nm; Ex/em = 510/610 nm (following photolysis and reaction with dna/rna)Scope of application:Live bacteria detection Matters needing attention:1.Please instantaneously centrifuge the product to the bottom of the tube before use, and then carry out subsequent experiments ; 2.the kit components contain fluorescent dyes, and attention should be paid to avoiding light during use and preservation ; 3.For your safety and health, please wear experimental clothes and disposable gloves... Read More |