| Description | Inquire | Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) uses RedNucleus I staining to detect cell cycle. RedNucleus I is a far-infrared nucleic acid dye with cell membrane permeability, which can quickly enter living cells, specifically bind to DNA, and perform cell cycle detection on living cells without RNase digestion. Compared with the traditional PI staining method, the cells do not need to be broken or fixed, and the operation is simpler. RedNucleus I is a fluorescent dye of double-stranded DNA, and the fluorescence intensity after binding to double-stranded DNA is proportional to the content of double-stranded DNA. The intracellular DNA content can be measured by flow cytometry, and then the cell cycle analysis can be carried out according to the distribution of DNA content. After RedNucleus I staining, assuming that the fluorescence intensity of G0 / G1 phase cells is 1, the theoretical value of the fluorescence intensity of G2 / M phase cells containing two copies of genomic DNA is 2, and the fluorescence intensity of S phase cells undergoing DNA replication is between 1-2. In addition, RedNucleus I is compatible with dyes such as Horizon BV / BUV, FITC and R-PE, and can be periodically detected after sample staining.The kit is usually used to detect the cell cycle of cultured adherent or suspended cells. If it is used for cell cycle detection of tissues, the tissues must be digested into a single cell state.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. this product is applicable to the detection of living cells and fixed cell cycle with certain limitations. Whether it is applicable to different types of cells needs to be determined after testing. If fixation is needed, it is recommended to use ice bath pre cooling 75-80% ethanol -20 ℃ to fix cells overnight. 3. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Instruction： Experimental materials ( self-provided )：①cell lines or other cell samples ( self-prepared ) ；②This kit ; ③ trypsin ( self-prepared ) ;④ Cell culture medium containing FBS ( self-prepared ) ; Experimental procedure： 1.Preparation of cell samples : ( 1 ) ( This step is for adherent cells, if suspended cells, can be carried out directly step ( 2 ) ) Digest cells with trypsin, add cell culture medium, gently blow away cells, collected into the centrifuge tube. Note : The number of cells on the machine needs to reach 50,000 and above, so the initial number of cells collected needs to be sufficient. ( 2 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. Carefully remove the supernatant, add about 1 mL of ice bath pre-cooled 1 × staining buffer ( 10 × staining buffer diluted with diH2O at 1 : 10 ), re-suspend the cells. Repeat once. ( 3 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. After the supernatant was discarded, 1 mL of culture medium was added to re-suspend the cells ( for fixed cells, 1 × PBS can also be used to re-suspend ). Gently flick the bottom of the centrifuge tube to properly disperse the cells to avoid cell aggregation. 2.Staining : 4 µL of RedNucleus I staining solution was added to each tube of cell samples, slowly and fully mixed, and incubated at room temperature in dark for 20 min ( or incubated at 37 ° C in dark for 5-10 min ). The optimal incubation time of different cells is different, and the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect. 3.Flow cytometry detection and analysis : Excited at 638 nm by flow cytometry, it is recommended to detect in RL3 or FL4 channels, or use RL1 and RL2 channels. Cell DNA content analysis and light scattering analysis were performed using appropriate analysis software.Scope of application：Cell cycle detection... Read More | Product introduction：Used to isolate lymphocytes from human organsMatters needing attention：1. samples, reagents and experimental environment in the whole process shall be carried out at 20 ± 2 ℃. In order to obtain the best experimental results, it is best to carry out the Product introduction：Used to isolate lymphocytes from human organsMatters needing attention：1. samples, reagents and experimental environment in the whole process shall be carried out at 20 ± 2 ℃. In order to obtain the best experimental results, it is best to carry out the experiment within 2 h of sampling. The longer the sample is stored, the worse the cell separation effect is. The separation effect is even worse after the sample is placed for more than 6 h, or even cannot achieve the purpose of separation. 2. in this experiment, it is better not to use plastic products with high polymerization materials (such as polystyrene), but use non-static, low static ionization heart tubes and glass products without alkali treatment, because the electrostatic effect will lead to cell adhesion, and the surface of alkali treated glass will become rough, which will affect the effect of cell separation. 3. aspirating too many lymphocyte layers and separation liquid layers will cause the granulocytes at the junction of separation liquid to be aspirated, thus increasing the number of mixed granulocytes. 4. when the amount of separating solution is greater than that of tissue single cell suspension sample, the separation effect is better.Scope of application：Lymphocyte isolation... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |