| Description | Inquire | Products Content:F666101Component500 U5000 UStorageF666101AFastStar Probe Buffer (for bisDNA)2×1.2 mL2×12 mL-20℃. Avoid freeze/thaw cycle. Protect from light.F666101BSuperFastStar DNA Polymerase (5U/µL)100 µL1 mL-20℃. Avoid freeze/thaw cycle. Protect from light.Products Content:F666101Component500 U5000 UStorageF666101AFastStar Probe Buffer (for bisDNA)2×1.2 mL2×12 mL-20℃. Avoid freeze/thaw cycle. Protect from light.F666101BSuperFastStar DNA Polymerase (5U/µL)100 µL1 mL-20℃. Avoid freeze/thaw cycle. Protect from light.Products IntroductionThis product is mainly used for PCR using bisulfite-treated DNA as template, in which SuperFastStar DNA Polymerase is a new high-efficiency hot-start enzyme modified by bis-monoclonal antibody, which is completely blocked at room temperature, thus effectively avoiding non-specific amplification caused by the non-specific binding of the primer to the template or the primer dimerization under the condition of room temperature. The optimized FastStar Probe Buffer (for bisDNA) contains PCR Buffer, dNTPs and Mg2+, etc., which is easy to use as customers only need to add templates, primers and probes.caveat1 Before use, please mix the product gently by turning it up and down after it has been completely melted and centrifuged briefly.2. Avoid repeated freezing and thawing of the product, which may degrade its performance. This product can be stored at -20℃ for a long period of time, protected from light. If frequent use is required within a short period of time, it can be stored at 2-8℃.Usage The following examples are conventional PCR reaction systems and conditions, which should be improved and optimized according to the template, primer structure and target fragment size.1.PCR reaction system Note: 1) Usually, better results can be obtained with a primer concentration of 0.2 µM, and 0.1-1.0 µM can be used as a reference for setting the range.2)The concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, so please refer to the instrument manual or the specific requirements for the use of each fluorescent probe to adjust the concentration.3)Usually the amount of DNA template is 10-100 ng of genomic DNA or 1-10 ng of cDNA as a reference. Since the templates of different species contain different copy numbers of the target gene, the templates can be diluted in gradients to determine the optimal amount of template to use.2.PCR reaction conditionsNote: 1) The initial denaturation of this product at 95°C for 30s is sufficient for enzyme activation; complex templates can be extended to 3min denaturation.(2) It is recommended to use two-step PCR reaction program, if you can't get good experimental results due to the use of primers with lower Tm value, etc., you can try three-step PCR amplification, and the annealing temperature should be set in the range of 56℃-64℃ as a reference... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The fluorescent dye PKH67 is suitable for conventional cell membrane labeling. It is a green fluorescent dye that can track cells in vitro and in vivo. It labels cells by binding to the lipid components of the membrane structure. PKH67 has low cytotoxicity, low fluorescence background, high fat The fluorescent dye PKH67 is suitable for conventional cell membrane labeling. It is a green fluorescent dye that can track cells in vitro and in vivo. It labels cells by binding to the lipid components of the membrane structure. PKH67 has low cytotoxicity, low fluorescence background, high fat solubility, can easily penetrate cell membranes, and has strong and stable green fluorescence. PKH67-labeled cells can be used for in vitro and in vivo proliferation studies, and have the function of not staining neighboring cells. In the process of cell division and proliferation, the fluorescence intensity of PKH67 will gradually decrease as the cells divide. The labeled fluorescence can be evenly distributed to the two sub-generation cells, so its fluorescence intensity is half that of the parent cell. According to this feature, It can be used to detect cell proliferation, cell cycle estimation and cell division, etc. The fluorescence of PKH67-labeled cells is very uniform, and the fluorescence distribution of sub-generation cells after division is also more uniform. In the process of cell division and proliferation, PKH67-labeled fluorescence can be evenly distributed between the two sub-generation cells, and the fluorescence intensity becomes half of that of the parent cell. According to the difference in fluorescence intensity, the undivided cells can be detected by flow cytometry. One time (1/2 the fluorescence intensity), the second time (1/4 the fluorescence intensity), three times (1/8 the fluorescence intensity), and more divisions of cells. PKH67 can detect splits up to six times or even more. In addition to the detection of cell proliferation, PKH67 can also be used for in vitro tracking of cells. After labeling, the fluorescence expression is stable in the cell, and the positive labeling rate is over 98%. The labeled cells have good morphology, which can effectively observe the cells in vitro. Induce differentiation; or inject labeled cells into the body, it can effectively show the migration and differentiation of transplanted cells in living tissues. PKH67-labeled cells can be used for in vivo observation for as long as several weeks. It is often used for in vivo cell detection experiments and experiments to observe long-term cell activity using fluorescence electron microscope. PKH67 is less toxic and does not affect cell proliferation. This method is simple to operate, does not use radioactive isotopes, and poses no safety hazards. You can get the desired experimental data faster, more accurately and more safely.Due to the longer length of the charcoal tail, internal studies have shown that PKH67 is less transferred between cells than PKH2. In in vivo studies using PKH1 and PKH2, the fluorescence intensity will slowly lose. Since this is a behavioral characteristic of green cell linker dye rather than red cell linker dye, PKH67 will have similar properties. The correlation between the in vitro cell membrane retention of non-dividing cells and the in vivo fluorescence half-life reveals that the in vivo fluorescence half-life of PKH67 is 10-12 days. Other green cell linker dyes with similar half-lives have been used to monitor the transport of lymphocytes and macrophages in the body within one to two months. The results indicate that PKH67 can also be used for medium-term in vivo tracking studies.The dye can stably bind to the lipid region of the cell membrane and emit fluorescence, and is mainly used for cell labeling in vitro, cell proliferation research in vitro, and cell tracing research in vivo and in vitro. The fluorescence half-life of PKH67 in vivo is 10-12 days. Compared with PKH-67, PKH-26 has a longer half-life, and the half-life of PKH26 labeled on rabbit red blood cells is more than 100 days. Especially suitable for in vitro proliferation research and long-term in vivo cell tracking research. After PKH67 labels the cells, flow cytometry is usually used for cell proliferation detection.Kit components0.1ml kits: P266290A-0.1ml P266290B-10ml1ml kits: P266290A-1ml P266290B-60mlDyes with A suffix and diluents with B suffix are used togetherPKH67 labeled cells show green fluorescence, the fluorescence wavelength: λex=490 nm, λem=502 nm.Storage conditions: -20℃ protected from light, valid for 1 yearPrecautions●Staining concentration varies according to the type of cell and the number of cells in each well.● The prepared PKH67 mother liquor is very easy to dissolve. It is recommended to store in aliquots and freeze-dry at ≦-20℃.● PKH67 working solution should be prepared for immediate use, and cannot be prepared in advance, because PKH67 will decompose due to the absorption of water and affect the dyeing effect.● PKH67 is easily decomposed and will deteriorate quickly in the water solution. Please avoid contact with water during use of mother liquor. The working fluid is in contact with the water during the process of labeling the cells within the permitted time range.● PKH67 fluorescent dye is a DMSO solution. It will solidify and stick to the bottom, wall or cap of the tube at a lower temperature such as 4℃ and ice bath. After being taken out of the refrigerator, it will return to room temperature and become After the liquid is in the state, remove the cap from the bottom of the tube. It can be used after it has completely melted in a 37°C water bath.● The number of generations or time that can be traced after different cell types are marked is quite different. Please make a test based on the actual situation or reference documents.Instructions1. Staining solution preparation:(1) Take out the PKH67 reagent from the refrigerator, let it stand for a few minutes to room temperature, or after a 37°C water bath, leave the tube containing PKH67, and be sure to leave the tube for a few minutes before opening the lid to allow the reagent to fully fall into the tube The lid can only be opened after the bottom.(2) According to the number of cell samples to be tested, dilute the probe 10 times with the diluent, and then use a suitable solution (such as non-clear medium, HBSS or PBS) to dilute the PKH67 mother liquor 25 times to prepare a stain Work fluid. The best working solution concentration should be adjusted according to different cells and your own experimental system. Generally, the cells can be diluted 250 times according to the final concentration of the mother liquor in the kit. Some cells may need to increase the concentration appropriately.2. Cell staining(1) Resuspend the prepared cells to be tested in 100µl of staining solution to a cell concentration of about 107/ml. You can also perform in-situ staining, as long as the staining solution is enough to cover the cells.(2) Culture the cells at 2~8℃ for 15~30 minutes. The best culture time is different for different cells.It is recommended to incubate the labeled cells in the staining solution at 37°C for 5 minutes, and then at 4°C for 15 minutes.Low-temperature incubation can reduce the endocytosis of the dye by the cells, help the dye to label the plasma membrane, and reduce the possibility of the dye localizing to cytoplasmic vesicles.(3) After separation, remove the supernatant, collect the cells, wash the cells 1-2 times with PBS or non-clear medium, and finally add PBS or non-clear medium to resuspend the cells.(4) Take 500µl of cell suspension and test with flow cytometer. Ex/Em=490/502nm.(5) Subsequently, the cells can be cultured according to the normal culture method.(6) The labeling effect can be directly observed under a fluorescence microscope, or the cell proliferation can be detected by a flow cytometer after an appropriate period of culture, or used for cell fluorescence traces for other specific experimental purposes... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export |