| Description | Inquire | B669951 Component 50T Storage B669951A Buffer ATL 15 mL RT B669951B Buffer AL 15 mL RT B669951C Buffer AW1 (concentrate) 13 mL RT B669951D Buffer AW2 (concentrate) 15 mL RT B669951E Buffer EB 15 mL RT B669951F Proteinase K 1.25 mL RT B669951G Spin Columns DM with Collection Tubes 50 sets B669951 Component 50T Storage B669951A Buffer ATL 15 mL RT B669951B Buffer AL 15 mL RT B669951C Buffer AW1 (concentrate) 13 mL RT B669951D Buffer AW2 (concentrate) 15 mL RT B669951E Buffer EB 15 mL RT B669951F Proteinase K 1.25 mL RT B669951G Spin Columns DM with Collection Tubes 50 sets RTProductsThis kit is suitable for extracting high purity total DNA from Gram-negative and Gram-positive bacteria. 106-108 cells can be processed at a time, and up to 20 µg of total DNA can be obtained within one hour without the need for toxic solvents such as phenol or chloroform, and without the need for ethanol precipitation. The optimized buffer system enables the DNA in the lysate to be efficiently and specifically bound to the silica matrix centrifugal adsorption column, while other contaminants can flow through the membrane, and the inhibitors of PCR and other enzymatic reactions can be effectively removed through a two-step washing step, and finally washed off with low-salt buffer or water, so that high-purity DNA can be obtained.The purified DNA can be used for downstream experiments such as digestion, PCR, Real-Time PCR, library construction, Southern Blot and molecular labeling, molecular labeling and other downstream experiments. Self-contained reagents: anhydrous ethanol; Enzymatic Lysis Buffer is required for extraction of Gram-positive bacteria.Enzymatic Lysis Buffer was prepared by 20 mM Tris, pH 8.0; 2 mM Na2-EDTA, pH 8.0; and 1.2% Triton X-100. 121°C sterilization for 20 minutes, and the appropriate amount of Lysozyme was added at a final concentration of 20 mg/ml. Pre-experiment Preparation and Important Notes1. Add 1.25ml Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity.2. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller DNA fragments and a decrease in the amount of extracted DNA.3. If extracting genomes from bacterial cultures with high accumulation of secondary metabolites or thick cell walls, it is recommended that samples be collected early in the logarithmic phase.4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the label of the reagent bottle before first use.5. Before use, please check Buffer GTL and Buffer GL for crystallization or precipitation. If crystallization or precipitation occurs, please re-dissolve Buffer GL and Buffer GTL in a 56℃ water bath.6. If the downstream experiments are sensitive to RNA contamination, 4µl of DNase-Free RNase A (100mg/ml) can be added before adding Buffer GL. RNase A is not provided in this kit.If the extracted samples are Gram-positive bacteria, customers need to prepare their own Enzymatic Lysis Buffer to treat the bacteria, which requires the use of Lysozyme (lysozyme) at a concentration of 20 mg/ml, which is not provided in this kit.Procedurei Extraction of genomic DNA from Gram-negative bacteria1. Take 1-5 ml of bacterial culture (106-108 cells, maximum 2×109 cells) and put it into a centrifuge tube (provided), centrifuge it at 12,000 rpm (~13,400×g) for 1 minute, and aspirate the supernatant as much as possible.2. Add 180 µl Buffer GTL to the precipitate and shake to resuspend the bacteria.3. Add 20 µl of Proteinase K, vortex and mix well, incubate at 56°C until the solution becomes clear, and invert or shake the centrifuge tube at intervals during the incubation to disperse the sample.Note: If RNA removal is required, add 4 µl of RNase A solution at a concentration of 100 mg/ml after the above steps are completed, shake to mix, and leave for 5-10 minutes at room temperature.4. Add 200µl Buffer GL and mix well with vortexing and shaking. Add 200µl of anhydrous ethanol and mix well with vortexing and shaking.Centrifuge briefly so that the solution on the walls of the tube collects at the bottom.Note: 1) If multiple samples are manipulated together, Buffer GL and anhydrous ethanol can be mixed in equal proportions and then added together, shaking to mix.2) The addition of Buffer GL and anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.5. Add all of the solution obtained in step 4 (including the precipitate formed) to the Spin Columns DM in the collection tube, or if the solution cannot be added all at once, transfer it several times. centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and return the column to the collection tube.6. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and return the adsorption column to the collection tube.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorbent column at room temperature for several minutes to dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).9. Place the adsorption column in a new centrifuge tube, add 50-200 µl Buffer GE to the middle part of the adsorption column overhanging the center of the adsorption column, leave it at room temperature for 2-5 minutes, centrifuge it at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20 ℃. note: 1) If the downstream experiments are sensitive to the pH or EDTA, the elution can be done with sterilized water. The pH of the elution solution has a great influence on the elution efficiency. If water is used as the elution solution it should be ensured that its pH is 7.0-8.5 (the pH of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH is lower than 7.0.2) Incubation at room temperature for 5 minutes prior to centrifugation increases yield.3) Re-elution with an additional 50-200 µl Buffer GE or sterilized water can increase the yield.4) If the final concentration of DNA is to be increased, the DNA eluate obtained in step 9 can be re-spiked onto the adsorbent membrane and step 9 repeated; if the elution volume is less than 200 µl, the final concentration of DNA can be increased, but the total yield may be reduced. If the amount of DNA is less than 1 µg, elution with 50 µl Buffer GE or sterilized water is recommended.(5) DNA stored in water will be affected by acidic hydrolysis. For long-term storage, it is recommended to elute with Buffer GE and store at -20℃.i. Extraction of genomic DNA from Gram-positive bacteria1. Take 1-5 ml of bacterial culture (106-108 cells, maximum 2×109 cells) and put it into a centrifuge tube (provided), centrifuge it at 12,000 rpm (~13,400×g) for 1 minute, and aspirate the supernatant as much as possible.2. Add 180µl Enzymatic Lysis Buffer (self-provided) to resuspend the bacteria.Enzymatic Lysis Buffer is prepared as described in the Self-Prepared Reagents section in the front of the manual.3. Incubate at 37°C for 30 minutes.4. Add 20µl Proteinase K and mix well. Add 200µl of Buffer GL and mix well with vortexing and shaking.Note: Do not add Proteinase K directly to Buffer GL.Incubate at 5.56°C for 30 minutes.Note: 1) If desired, incubation at 95°C for 15 minutes will inactivate the pathogen, but 95°C incubation will cause some DNA degradation.(2) If RNA removal is required, add 4µl of RNase A solution at a concentration of 100mg/ml after the above steps are completed, shake and mix well, and leave for 5-10 minutes at room temperature.6. Add 200µl of anhydrous ethanol and mix well with vortex shaking.Note: The addition of anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.7. Add all of the solution obtained in step 6 (including the precipitate formed) to the Spin Columns DM that have been loaded into the collection tube, and if the solution cannot be added all at once, it can be transferred in several times. centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid from the collection tube, and put the column back into the collection tube.8. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.9. Add 500 µl Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge the column at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the column back into the collection tube.Note: Step 9 can be repeated if further DNA purity is required.10. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).11. Place the adsorption column in a new centrifuge tube (self-provided), add 50-200 µl of Buffer GE to the center of the adsorption column overhanging the center of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store the DNA at -20℃.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent should ensure that its pH is 7.0-8.5 (you can use NaOH to adjust the pH of the water to this range), and the elution efficiency is not high when the pH is lower than 7.0.2) Incubation at room temperature for 5 minutes prior to centrifugation increases yield.3) Re-elution with an additional 50-200 µl Buffer GE or sterilized water can increase the yield.4) If the final concentration of DNA is to be increased, the DNA eluate obtained in step 11 can be re-spiked onto the adsorbent membrane and step 11 repeated; if the elution volume is less than 200 µl, the final concentration of DNA can be increased, but the total yield may be reduced. If the amount of DNA is less than 1 µg, elution with 50 µl Buffer GE or sterilized water is recommended.(5) DNA stored in water will be affected by acidic hydrolysis. For long-term storage, it is recommended to elute with Buffer GE and store at -20℃... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products content S666097Component200 TStorageS666097A5×SuperFast One Step RT-qPCR U+ Buffer1 mL-20℃. Avoid freeze/thaw cycle.S666097BSuperFast One Step U+ Enzyme200 µL-20℃. Avoid freeze/thaw cycle.S666097CRNase-Free Water2×1.5 mL-20℃. Avoid freeze/thaw cycle. Products content S666097Component200 TStorageS666097A5×SuperFast One Step RT-qPCR U+ Buffer1 mL-20℃. Avoid freeze/thaw cycle.S666097BSuperFast One Step U+ Enzyme200 µL-20℃. Avoid freeze/thaw cycle.S666097CRNase-Free Water2×1.5 mL-20℃. Avoid freeze/thaw cycle. Products IntroductionThe SuperFast Probe One Step RT-qPCR U+ Kit is designed for quantitative PCR assays using RNA as a template (e.g., RNA viruses). Using gene-specific primers (GSP), reverse transcription and qPCR reactions are completed in a single tube, eliminating the need for additional tube-opening/pipetting operations, greatly increasing throughput and reducing the risk of contamination. The dUTP/UNG anti-contamination system is introduced in this kit. The heat-sensitive UNG rapidly degrades U-containing contaminants at room temperature; it is rapidly inactivated by reverse transcription at 55°C, without affecting the efficiency and sensitivity of qRT-PCR. Combined with optimized buffer systems and antibody-modified Taq enzymes and mutated M-MLV, the SuperFast Probe One Step RT-qPCR U+ Kit provides sensitivity up to 0.1 pg of total RNA or <10 copies of RNA template and enhanced thermal stability. 5× SuperFast One Step RT-qPCR U+ Buffer contains the following components The 5× SuperFast One Step RT-qPCR U+ Buffer contains an optimized buffer system and dNTP/dUTP Mix, which is particularly suitable for high specificity, low template concentration and multiplexed rapid detection of fluorescently labeled probes such as TaqMan. caveatBefore use, please mix the product gently by turning it up and down after it is completely melted to avoid foaming, and use it after brief centrifugation. Avoid repeated freezing and thawing of the product.ROX dye is used to correct the fluorescence signal error between the quantitative PCR wells, this product does not contain ROX dye, if you need to match the ROX dye with the instrument you are using, please contact your local business or call CombiSense customer service at 4006-222-360. PCR reaction system Attention: (1) Usually, the final primer concentration of 0.2 µM can get better results, and 0.1-1.0 µM can be used as a reference for setting the range. If the amplification efficiency is not high, the concentration of primer can be increased; if non-specific reaction occurs, the concentration of primer can be decreased to optimize the reaction system.(2) The final concentration of the probe used is related to the fluorescence quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance, please refer to the instrument manual or the specific requirements for the use of each fluorescent probe to adjust the concentration.3) Because templates from different species contain different numbers of copies of the target gene, the template can be diluted in a gradient to determine the optimal amount of template to usePCR reaction conditionsmovetemptimingcirculatereverse transcription55°C1 min1premutability95°C10s1)1denaturation95°C1 s40-45Annealing/Extension55-60°C2)10-15s3)40-45Attention: (1) The enzyme used in this product is activated under the condition of pre-denaturation at 95℃ for 30s. Under this condition, most of the templates can be well unchained. For templates with high GC content and complex secondary structure, the pre-denaturation time can be extended to 1min, so as to make the starting template fully unchained, and if the high temperature treatment time is too long, it will affect the activity of the enzyme; for simple templates, pre-denaturation time of 1-10s can also be used, and the optimal pre-denaturation time can be determined according to the template situation.(2) It is recommended to use two-step PCR reaction program, the annealing temperature should be 55-60℃ as the reference range, and the annealing temperature can be increased when non-specific reaction occurs. If you can't get good results due to the use of primers with low Tm values or long amplification products, you can try three-step PCR amplification.3) Whether the actual Real Time PCR instrument used supports rapid amplification cycles, please perform a pre-experiment to verify this for the first attempt... Read More |