| Description | Inquire | Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm.Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm. In the early stage of apoptosis, different types of cells will turn phosphatidylserine out to the cell surface and expose to the extracellular environment. At this time, using Annexin V labeled with fluorescent protein PE, that is, Annexin V-PE, combined with phosphatidylserine ( PS ), the eversion of phosphatidylserine, an important feature of apoptosis, can be directly detected by flow cytometry. Normal cells will not be stained by Annexin V-PE, apoptotic or necrotic cells will be stained by Annexin V-PE. Annexin V-PE can be used in combination with partially non-permeable nuclear dye ( 7-AAD / PI ) to distinguish cells at different stages of apoptosis. RedNucleus II provided in this kit is a far-red dye that belongs to an anthraquinone compound and cannot penetrate the intact cell membrane of living cells and early apoptotic cells. It is non-permeable, but can quickly stain the nucleus / dsDNA in dead and permeable cells. RedNucleus II is an ideal substitute for propidium iodide ( PI ) and 7-AAD.Combined with Annexin V-PE, it has better spectral characteristics without compensation regulation : it is not excited by ultraviolet light and does not overlap with PE / PE homologues, so it can be combined with FITC, PE and purple fluorescent dyes for multicolor analysis. When combined with Annexin V-PE, RedNucleus II was excluded from living cells and early apoptotic cells, while late apoptotic cells and dead cells were double-positive for Annexin V-PE and RedNucleus II. Annexin V-PE / RedNucleus II apoptosis detection kit can be detected by flow cytometry or other fluorescence detection equipment. Components: Components A598354(10T) A598354(50T) A598354(100T) A. 1×Annexin V Combining buffer solution 10 mL 50 mL 50 mL×2 B. Annexin V-PE 50 µL 250 µL 500 µL C. RedNucleus II 100 µL 500 µL 1 mLProduct parameters：Annexin v-pe:ex/em=488/578 nmrednucleus ii:ex/em=635/695 NMUsage method:1. Experimental design: Blank tube: Negative control group cells, without Annexin V-PE/RedNucleus II. Used to regulate voltage.Single staining tube: Positive control group cells were treated with Annexin V-PE alone/RedNucleus II alone. Used for adjusting compensation.Detection tube: Add Annexin V-PE/RedNucleus II to the processed cells. After adjusting the voltage compensation using blank tubes and single dye tubes, obtain the required flow data.2. Collect cells(1) For suspended cells:a. After inducing cell apoptosis, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS, and count them.Note: PBS resuspension cannot be omitted. The process of PBS resuspension also serves to wash cells, ensuring the subsequent binding of Annexin V-PE.b. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. c. Add 5 µ L Annexin V-PE and mix gently.d. Add 5 µ L of RedNucleus II staining solution and mix gently.e. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.(2) For adherent cells:a. Suck out the cell culture medium into a suitable centrifuge tube, wash the adherent cells with PBS once, and add an appropriate amount of trypsin cell digestion solution (without EDTA) to digest the cells. Incubate at room temperature until gently blowing can remove the trypsin cell digestion solution when the adherent cells are blown down. Overdigestion of pancreatic enzymes should be avoided.Note: For adherent cells, the trypsin digestion step is crucial. If the trypsin digestion time is too short, cells need to be blown hard to detach, which can easily cause damage to the cell membrane and lead to false positives of cell necrosis; If the digestion time is too long, it can also cause cell membrane damage and false positives of cell necrosis, and even affect the binding of phosphatidylserine and Annexin V-PE on the cell membrane, thereby interfering with the detection of cell apoptosis.b. Add the cell culture medium collected in the previous step, gently blow down the cells, transfer them to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS and count them.Note: Adding the cell culture medium from the previous step is very important. On the one hand, it can collect cells that have already been suspended and undergone apoptosis or necrosis. On the other hand, the serum in the cell culture medium can effectively inhibit or neutralize residual trypsin. The residual trypsin will digest and degrade the subsequently added Annexin V-PE, leading to staining failure.c. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. d. Add 5 µ L Annexin V-PE and mix gently.e. Add 5 µ L of RedNucleus II staining solution and mix gently.f. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.3. Result analysis:(1) Flow cytometry detection:a. After incubation, 400 µ L of 1 × Annexin V binding buffer can be directly added to resuspend the cells, and immediately detected on the machine. Annexin V-PE is excited by 488 nm/566 nm laser, and the fluorescence emission spectrum is detected at 578 nm (BL2 (FL2)/YL1 channel), while the RedNucleus II channel emission spectrum is approximately at 695 nm (RL1 (FL4) channel).b. On the scatter plot of the bivariate flow cytometer, live cells are shown in the lower left quadrant, which is (Annexin V-PE -/RedNucleus II -); The lower right quadrant represents early apoptotic cells, which are (Annexin V-PE+/RedNucleus II -); The upper right quadrant represents necrotic and late stage apoptotic cells, which are (Annexin V-PE+/RedNucleus II+); The upper left quadrant displays naked nuclear cells, which are (Annexin V-PE -/RedNucleus II+).(2) Fluorescence microscopy detection:a. Centrifuge at 1000 rpm for 5 minutes, collect cells, and gently resuspend them in 400 µ L of 1 × Annexin V binding buffer. Transfer the cells to a 96 well plate and settle for a moment or perform cell smear, then observe under a fluorescence microscope.b. Annexin V-PE is compatible with PE filters. RedNucleus II can use a far red long pass filter.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. to reduce the process of apoptosis, the incubation process can be operated on ice, but the incubation time should be extended to at least 30 min. 3. as apoptosis is a rapid process, it is recommended that samples be analyzed within 1 h after staining. 4. for adherent cells, digestion is a key step. If there are floating cells when adherent cells induce apoptosis, the floating cells and adherent cells should be collected and stained. Handle adherent cells with care to avoid artificial damage to cells. The trypsin digestion time is too short, and the cells need to be blown hard to fall off, which is easy to cause damage to the cell membrane and excessive intake of rednucleus II; If the digestion time is too long, the cell membrane is also prone to damage, and even affect the binding of phosphatidylserine and annexin v-pe on the cell membrane. When digesting, spread pancreatin on the bottom of the well plate, fully contact the pancreatin with the cells when shaking gently, then pour out most of the pancreatin, use the remaining small amount of pancreatin to digest for a period of time, and terminate when the gap between cells increases and the bottom of the bottle is spotted. Try not to use EDTA in the digestive juice, which will affect the binding of annexin V to PS. 5. after the adherent cells are digested with trypsin, it is recommended to stain after recovering in the optimal culture conditions and medium for about 30 min to avoid false positives. 6. in order to avoid losing cells when washing cells, you can use a large tip over a small tip to aspirate. 7. the optimal concentration of dye is determined by the specific experimental requirements. 8. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 9. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Early apoptosis detection, annexin V Kit... Read More | FFPE DNA/RNA KitFixed Tissue DNA/RNA Extraction Kit Catalog number: F666120 (50 preps)Storage conditions: DNase I and 10×Reaction Buffer -20℃, Spin Columns DF and Spin Columns RS can be stored at room temperature for 2 months, 2-8℃ for 1 year, the rest of the components are stored FFPE DNA/RNA KitFixed Tissue DNA/RNA Extraction Kit Catalog number: F666120 (50 preps)Storage conditions: DNase I and 10×Reaction Buffer -20℃, Spin Columns DF and Spin Columns RS can be stored at room temperature for 2 months, 2-8℃ for 1 year, the rest of the components are stored at room temperature (15-30℃).Products Content:Products IntroductionThis kit is suitable for the effective purification of genomic DNA and total RNA from paraffin-embedded tissues, using specially optimized deparaffinizing agents and lysates to release DNA and RNA from tissue section samples, without the use of the organic reagent xylene, and without the need for overnight operation; the digested samples are incubated at higher temperatures to remove inhibitors caused by cross-linking, which can effectively improve nucleic acid yields and purity; and an optimized buffer system allows nucleic acids in the lysate to bind specifically to the adsorbent membrane, and inhibitors are effectively removed by a two-step rinsing procedure. The optimized buffer system enables the nucleic acids in the lysate to bind specifically to the adsorbent membrane, and the inhibitors are effectively removed by a two-step rinsing step, and finally eluted with low-salt buffer or water to obtain high purity DNA and RNA, and at the same time, equipped with a high-efficiency microsorbent column, the volume of the elution can be as low as 20 µl. The purified DNA and RNA can be directly used for PCR, Real-time PCR, SNP genotyping, STR genotyping, and so on. The purified DNA and RNA can be directly used for PCR, Real-time PCR, SNP genotyping, STR genotyping, second-generation sequencing, pharmacogenomics research and blot analysis.Self-contained reagent: anhydrous ethanolPre-experiment Preparation and Important Notes 1. After obtaining the sample, fix the sample as soon as possible, the fixation time of 14-24 hours is appropriate, too long a period of time will easily lead toDNA and RNA breaks, affecting downstream experiments. If the formaldehyde fixation time is too long or the sample is stored for too long(>1 year) is prone to compromise DNA integrity and failure to amplify long fragments.2. Ensure that samples are thoroughly dehydrated prior to embedding; residual formalin will inhibit Proteinase K action.3. Add 1.25 ml of Proteinase K Storage Buffer to Proteinase K to dissolve it, and store at -20℃. Do not leave the prepared Proteinase K at room temperature for a long period of time to avoid affecting its activity.4. Anhydrous ethanol should be added to Buffer RW2, Buffer GW1 and Buffer GW2 according to the label instructions on the vials before first use.5. Check Buffer GTL, Buffer GL and Buffer DS for crystallization or precipitation prior to use; if crystallization or precipitation occurs, redissolve Buffer GTL, Buffer GL and Buffer DS in a 37°C water bath.6. Preheat the water bath or thermostatic mixer to 56°C before starting the experiment.7. Use an ambient temperature centrifuge or set the centrifuge temperature to 25°C. Temperatures below 15°C may result in clogging of the adsorption column.8. To prevent RNase contamination, the following should be observed:1) Use RNase-free plastics and tips to avoid cross-contamination.(2) Glassware should be dry baked at 180°C for 4 hours before use, plasticware can be soaked in 0.5 M NaOH for 10 minutes, rinsed thoroughly with water and autoclaved.3) RNase-free water should be used to prepare the solution.(4) Operators wear disposable masks and gloves, and change gloves diligently during the experiment.procedureParaffin-embedded samples1. Trim off excess paraffin from the tissue block to expose the tissue and cut into 5-10 µm slices.2. Place approximately 1 x 1 cm2 slices (1-5 slices in total) in a centrifuge tube (supplied), add 500 µl of Buffer DS and vortex for 10 s. Briefly centrifuge the sample to the bottom of the tube. Centrifuge briefly to collect the sample at the bottom of the tube, incubate at 56°C for 3 minutes, remove from the water bath and allow to cool to room temperature before proceeding.Note: If the surface of the sample is exposed to air, discard the initial 2-3 slices without using them.3. Centrifuge at 12,000 rpm for 2 minutes and carefully discard the supernatant thoroughly without aspirating the precipitate. The residual dewaxing solution can be carefully removed with a small tip (10 µl).4. Add 180 µl of Buffer GTL and 20 µl of Proteinase K to the above tube and mix well with vortexing.5. Incubate at 56°C for 15 minutes, then place on ice for 3 minutes. Centrifuge at 12,000 rpm for 15 minutes at room temperature.6. Transfer the supernatant to a new 1.5 ml centrifuge tube for RNA extraction, taking care not to aspirate undigested tissue. Use the precipitate for DNA extraction. RNA extraction7. Take the supernatant obtained in step 6 and incubate at 80°C for 15 minutes.8. Add 320 µl of Buffer GL, mix by vortexing and shaking, then add 720 µl of anhydrous ethanol and mix immediately by vortexing and shaking.9. Add all of the resulting solution to the Spin Columns RS in the collection tube; if the solution cannot be added all at once, it may be transferred in several passes. centrifuge the column at 12,000 rpm for 1 minute, pour off the waste solution from the collection tube, and place the column back into the collection tube. Note: If the columns are clogged, the sample size may be too large and consideration should be given to reducing the number of starting sections to 1-2.Optional step: If genomic DNA is to be removed, the following steps can be followeda. Add 350 µl of Buffer RW1 to the column, centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and place the column back into the collection tube.b. Preparation of DNase I mixture: Take 52 µl of RNase-Free Water and add 8 µl of 10×Reaction to it.Buffer and 20 µl DNase I (1 U/µl), mix well, and prepare a final volume of 80 µl of reaction solution.c. Add 80 µl of DNase I Mix directly to the adsorption column and incubate at 20-30°C for 15 minutes.d. Add 350 µl of Buffer RW1 to the column, centrifuge at 12,000 rpm for 1 minute, discard the waste solution, and return the column to the collection tube.Add 500 µl of Buffer RW2 to the adsorbent column, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.11. Repeat step 10. centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Place the column at room temperature for 5 minutes.minutes to dry thoroughly.12. Place the column in a new RNase-free centrifuge tube and add 20-50 µl to the center of the column.RNase-Free Water, left at room temperature for 5 minutes, centrifuged at 12,000 rpm for 1 minute, and collected RNA solution, the-80°C for storage.DNA extraction7. Take the precipitate obtained in step 6 and add 180 µl Buffer GTL and 20 µl Proteinase K to the precipitate. VortexResuspend the precipitate for 15 seconds.8. Incubate at 56°C for 1 hour until the sample is completely dissolved. 90°C for 1 hour.Add 200 µl Buffer GL, vortex and shake to mix and then add 200 µl anhydrous ethanol, vortex and shake to mix thoroughly. Centrifuge briefly so that the solution on the wall of the tube collects at the bottom of the tube. Add all of the solution from step 9 to the Spin Columns DF in the collection tube, or transfer the solution in several passes. centrifuge at 12,000 rpm for 1 minute, pour off the waste solution from the collection tube, and return the column to the 10. collection tube.Note: If the adsorption column is clogged, the sample size may be too large and consideration should be given to reducing the number of starting sections to 1-2.11. Add 500 µl of Buffer GW1 to the adsorbent column and centrifuge at 12,000 rpm for 1 minute. Pour off the waste liquid from the collection tube and put the column back into the collection tube.12. Add 500 µl of Buffer GW2 to the adsorbent column and centrifuge at 12,000 rpm for 1 minute. Pour off the waste liquid from the collection tube and place the column back into the collection tube.Note: Step 12 may be repeated if further purity is required.13. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for 5 minutes to dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorbent column; ethanol residue will affect the subsequent enzymatic reaction. 14. Place the column in a new 1.5 ml centrifuge tube, add 20-50 µl Buffer EB to the center of the column, leave at room temperature for 5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store at -20℃... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Products contentN665978Component384 TStorageN665978AIndex N502-N522 Primers for Illumina 16×24 µL-20℃. Avoid freeze/thaw cycle.N665978BIndex N701-N729 Primers for Illumina24×16 µL-20℃. Avoid freeze/thaw cycle. Products IntroductionThis kit is a companion to the Products contentN665978Component384 TStorageN665978AIndex N502-N522 Primers for Illumina 16×24 µL-20℃. Avoid freeze/thaw cycle.N665978BIndex N701-N729 Primers for Illumina24×16 µL-20℃. Avoid freeze/thaw cycle. Products IntroductionThis kit is a companion to the transposase-based rapid DNA library construction kit, designed for Illumina platform library construction. It contains 16 N5 primers and 24 N7 primers, which can be used to prepare 384 different bipartite Index libraries. All reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. The libraries can be used for sequencing on Illumina platforms such as HiSeq X-10/4000/2500/2000 and MiSeq.Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 is recommended.2. DNA purification and recovery kit: It is recommended to use Kangwei DNA purification and recovery kit by magnetic bead method.3. DNA building kit: It is recommended to use the Kangwei Century transposase method second-generation sequencing rapid DNA building kit.4. Anhydrous ethanol.5. Reaction tubes: It is recommended to use low adsorption PCR tubes with 1.5 ml centrifuge tubes; Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and library samples. Pre-experiment Preparation and Important NotesPlease centrifuge briefly before opening the cap so that the liquid collects at the bottom of the tube to avoid cross-contamination between different primers.procedure For the use of the CombiVision Second Generation Sequencing Multisample Primer Kit, please follow the CombiVision Second Generation Sequencing Rapid DNA Library Kit protocol. Index N502-N522 Primers for Illumina Index N701-N729 Primers for Illumina... Read More |