| Description | Inquire | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligationProduct content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligation of DNA sticky or flush ends in 5 minutes at room temperature (25°C). The kit contains Quick T4 DNA Ligase and 2×Quick Ligation Reaction Buffer optimized for fast and efficient DNA ligation.The ligation efficiency of Quick Ligation is equivalent to 1 hour of conventional ligation with T4 DNA Ligase. The Quick Ligation products can be used directly in routine bacterial transformation experiments.matters needing attention1. This kit enables most of the linkage reactions to reach the reaction endpoint within 5 minutes or less at 25°C. Increasing the reaction time will not enhance the reaction efficiency. If you use the rapid connection reaction after 1 hour, the conversion efficiency will be significantly reduced; if the rapid connection reaction at 25 ℃ overnight, the conversion efficiency will drop to 75%.2. 2×Quick Ligation Reaction Buffer contains ATP, which should be thawed on ice and mixed thoroughly before use. It is recommended to freeze the buffer in small tubes for the first time, so as to avoid repeated freezing and thawing, which will affect the efficiency of DNA ligation.3. Since T4 DNA Ligase contains glycerol, which is sticky and easy to hang on the wall, it is recommended to collect the liquid to the bottom of the tube by centrifugation for a short period of time before use, and the tip of the lance should not go too deep into the liquid surface when taking samples to avoid sticking to the tip of the lance and causing losses.4. If the quick ligation product is used for electrotransformation, the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation, and it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation.Usage1. The reaction solution was prepared according to the following system:*The amount of Insert DNA used: the molar ratio of Vector DNA and Insert DNA is generally 1:3-1:8, and the appropriate molar ratio of Vector DNA and Insert DNA can be selected according to the experimental situation.Calculation of DNA molar number: DNA molar number (nmol)=DNA mass (ng)/( 660daltons x number of inserted DNA bases bp).2. mix gently and centrifuge briefly. react at 25°C for 5 minutes.Note: The reaction time should not exceed 15 minutes, otherwise the connection efficiency will be reduced.3. Do not perform heat inactivation reactions. Centrifuge instantly and collect the solution from the wall to the bottom of the tube.Note: Heat inactivation significantly reduces transformation efficiency due to the presence of PEG in the buffer.4. After the reaction, store the DNA ligation product at 0-4℃, and then carry out transformation experiments; you can also store the DNA ligation product at -20℃.Note: When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.5. Heat shock the ligation product to transform 50 µl of receptor cells or take 1-2 µl of ligation product to electroshock transform 50 µl of receptor cells.Note: 1) When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.(2) If the quick ligation product is used for electrotransformation, it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation because the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation... Read More | Product contentU665751Component100 TStorageU665751A2×UltraSYBR One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751BUltraSYBR One Step EnzymeMix50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751C50×High ROX50 µL-20℃. AvoidProduct contentU665751Component100 TStorageU665751A2×UltraSYBR One Step Buffer1.4 mL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751BUltraSYBR One Step EnzymeMix50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751C50×High ROX50 µL-20℃. Avoid freeze/ Thaw cycle. Protect from light.U665751DRNase-Free Water1.5 mL-20℃. Avoid freeze/ Thaw cycle. Product Introduction This product is a specialized kit for one-step Real-Time RT-qPCR. The SYBR Green I fluorescent dye contained can bind to all double-stranded DNA, allowing this product to be used for the detection of many different target sequences without the need to synthesize specific labeling probes. Real Time RT-qPCR reaction using this product, reverse transcription and quantitative PCR are carried out in the same reaction system, there is no need to add reagents during the reaction, no need to open the cap of the tube, avoiding contamination while improving the efficiency of the experiment. The new high-efficiency reverse transcriptase RNase H is activity-deficient, which reduces the degradation of RNA in the reverse transcription reaction. The enzyme has high reverse transcription efficiency and can perform a good reverse transcription reaction on a small amount of RNA template. It has high affinity to RNA and can read through RNA templates with high GC content and complex secondary structure. New efficient hot start enzyme, the enzyme activity is closed at room temperature, thus effectively avoiding non-specific amplification caused by non-specific binding of primers and templates or primer dimerization at room temperature, which greatly improves the accuracy of fluorescence quantitative PCR reaction. The included buffer system maximizes the efficacy of both enzymes at the same time and improves efficiency. This product has high sensitivity, high specificity, wide linear range, and more accurate quantification of target genes.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used with Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument. Instruments that do not require ROX calibration (U665567) Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96 and others. Instruments that require High ROX calibration (U665751) ABI Prism 7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, and others.matters needing attention1. Before using the reagents in this kit, please mix them gently by turning them up and down to avoid foaming as much as possible, and use them after brief centrifugation.2. This product uses RNA as the template for one-step RT-PCR experiment, RNase contamination should be avoided during operation, it is recommended to operate RNA in a special area, use special instruments and consumables, the operator with a mask and disposable gloves and often change the gloves, the experiment-related consumables should be processed with 0.1% DEPC (diethyl ether of pyrocarbonate) aqueous solution at 37℃ for 12 hours and autoclaved for 30 minutes before use. Sterilize for 30 minutes before use.3. UltraSYBR One Step RT-qPCR Buffer contains SYBR Green I fluorescent dye. Avoid bright light when storing this product or preparing PCR reaction solutions.4. Repeated freezing and thawing of each reagent in this kit should be avoided; repeated freezing and thawing may degrade the product performance. This product can be stored for a long time at -20℃, protected from light. If frequent use is required in the short term, it can be stored at 2-8℃.5. This kit must use specific primers, the choice of primers can be selected according to specific experiments, the good or bad primer design directly affects the results of RT-PCR reaction, the design of primers need to consider the GC content, primer length, primer position, the secondary structure of the PCR product and other factors, it is recommended to use a professional primer design software for design.6. This product cannot be used for fluorescent quantitative PCR by the probe method.Usage1. Dissolve RNA template, primers, 2× UltraSYBR One Step Buffer, UltraSYBR One Step EnzymeMix and RNase-Free Water and set aside on ice.2. PCR reaction system:Reagents25 µl Reaction systemFinal concentration2×UltraSYBR One Step Buffer12.5 µl1×Forward Primer，10 µM0.5 µl0.2 µM¹⁾Reverse Primer，10 µM0.5 µl0.2 µM¹⁾UltraSYBR One Step EnzymeMix0.5 µl RNA TemplateX µl10 pg – 100 ng50×Low ROX or High ROX（optional）2）0.5 µl1×RNase-Free Waterup to 25 µlNote: 1) Usually, the primer concentration of 0.2µM can get better results, and the final concentration of 0.1-0.5µM can be used as a reference for setting the range. If the amplification efficiency is not high, the concentration of primer can be increased; when non-specific reaction occurs, the concentration of primer can be decreased, thus optimizing the reaction system.(2) The excitation optical system varies from instrument to instrument, choose to add 50×Low ROX or 50×High ROX according to the instrument using fluorescence quantification.3. Vortex and shake to mix, centrifuge briefly, and collect the solution at the bottom of the tube.4. RT-qPCR reaction conditions (fluorescence quantitative PCR is a two-step method), this program is based on the ABI 7500 fluorescence quantitative PCR instrument as an exampleNote: 1) It is recommended to use two-step PCR reaction program, if you improve the reaction specificity, you can increase the annealing temperature to 60-64 ℃ as a reference for the setting range; if you do not get good experimental results due to the use of primers with lower Tm values, etc., you can try to carry out three-step PCR amplification.(2) For melting curve analysis, please set up the program recommended by the fluorescence quantitative PCR instrument used, and this program is set up with the ABI 7500 fluorescence quantitative PCR instrument as a reference.RT-qPCR reaction conditions (fluorescence quantitative PCR was a three-step method):Note: 1) For three-step PCR amplification, please use the range of 56℃-64℃ as the setting reference for the annealing temperature.(2) For melting curve analysis, please set up the program recommended by the fluorescence quantitative PCR instrument you are using, this program is ABI750 fluorescent quantitative PCR instrument as a reference setting... Read More |