| Description | Inquire | B665530 Component 50 T 200 T Storage B665530A Buffer RCL 125 mL 2×260 mL 2-8℃ B665530B Buffer GR 15 mL 50 mL RT B665530C Buffer GL 15 mL 50 mL RT B665530D Buffer GW1 (concentrate) 13 mL 52 mL RT B665530E Buffer GW2 (concentrate) 15 mL 50 mL RT B665530F Buffer GE 15 mL 60 mL RT B665530G B665530 Component 50 T 200 T Storage B665530A Buffer RCL 125 mL 2×260 mL 2-8℃ B665530B Buffer GR 15 mL 50 mL RT B665530C Buffer GL 15 mL 50 mL RT B665530D Buffer GW1 (concentrate) 13 mL 52 mL RT B665530E Buffer GW2 (concentrate) 15 mL 50 mL RT B665530F Buffer GE 15 mL 60 mL RT B665530G Proteinase K 1.25 mL 4×1.25 mL RT B665530H Spin Columns DM with Collection Tubes 50 sets 200 sets RTProduct IntroductionThis reagent kit is suitable for extracting total DNA, including genomic DNA, mitochondrial DNA, and viral DNA, from fresh or frozen whole blood (blood samples treated with anticoagulants such as citrate, EDTA, or heparin), plasma, serum, erythrocyte sedimentation rate brown layer, lymphocytes, cell-free body fluids, and other samples. This product can process 0.1-1 mL of whole blood with a maximum yield of 30% µ g. It can purify DNA with sizes ranging from 100 bp to 50 kb. The purified DNA has high yield and good quality, and can remove protein, pigment, lipid, and other inhibitory impurities to the maximum extent. It can be directly used for PCR, fluorescence quantitative PCR, enzyme digestion, and Southern Blot experiments.Self prepared reagent: anhydrous ethanol.Preparation and important precautions before the experiment:1. The sample should avoid repeated freeze-thaw cycles, otherwise it may result in smaller extracted DNA fragments and a decrease in extraction volume.2. This reagent kit can extract up to 0.1-1 mL of whole blood samples or 1 × 107 white blood cells.3.Before the first use, anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the reagent bottle label.4. Before use, please check if there is any crystallization or precipitation in the Buffer GL. If there is any crystallization or precipitation, please incubate the Buffer GL in a 56 ℃ water bath and dissolve it again.5. The Buffer RCL in the reagent kit cannot be used again after being turbid.Operation steps:1. Sample processing: 1a When extracting 200 uL of blood sample, add the sample to the centrifuge tube (provided) and proceed directly to the next step of the experiment. 1b When the blood sample size is less than 200 µ When L, add Buffer GR to make up for 200 µ L. Proceed to the next step of the experiment. 1c When the blood sample size exceeds 200 µ When L is reached, add 1-2 times the volume of Buffer RCL, gently vortex or invert and mix well. Centrifuge at 12000 rpm (~13400 × g) for 1 minute and carefully discard the supernatant. If there is still red in the sediment, repeat the above steps once. Then add 200 to the precipitate µ Shake the buffer GR until thoroughly mixed before proceeding to the next step of the experiment. 1d If the processed blood sample is anticoagulant from poultry, birds, amphibians, or lower level organisms, its red blood cells are nucleated cells, and the blood sample size is 5-20 µ L. Can be added to Buffer GR to make up to 200 µ Follow up experiments will be conducted afterwards. Note: If downstream experiments are sensitive to RNA, 4 can be added µ L RNase A (100mg/mL) solution, shake for 15 seconds, and leave at room temperature for 5 minutes. RNase A reagent kit is not provided. If needed, you can order it separately from our company, item number: CW0601S.2. Add 20 to the above solution µ L Protein K, mix well.3. Add 200 µ Shake with L Buffer GL until thoroughly mixed. Note: Do not pre mix Protein K and Buffer GL.4.Incubate at 4.56 ℃ for 10 minutes, invert and mix several times during this time. Attention: The DNA production has reached its maximum after 10 minutes of incubation, and further extension of incubation time has no effect on DNA production and purity.5. Add 200 µ L anhydrous ethanol, invert and mix several times. Short centrifugation causes the liquid on the tube wall and wall cover to concentrate at the bottom of the tube.6. Add all the solution obtained in step 5 to the spin columns DM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred multiple times. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 500 to the adsorption column µ L Buffer GW1 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Note: If the extracted sample is the blood genome of species such as mice or monkeys that are difficult to remove heme, it is recommended to repeat step 7.8. Add 500 to the adsorption column µ L Buffer GW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube. Note: To further improve DNA purity, repeat step 8.9.Centrifuge at 9.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.)10. Place the adsorption column in a new centrifuge tube (provided by oneself) and add 50-200 to the middle of the adsorption column in the air µ L Buffer GE or sterilized water, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect DNA solution, and store DNA at -20 ℃. Note: 1) If downstream experiments are sensitive to pH or EDTA, they can be washed off with sterilized water. The pH value of the eluent has a significant impact on the elution efficiency. If water is used as the eluent, its pH value should be ensured to be between 7.0-8.5 (NaOH can be used to adjust the pH value of the water to this range). When the pH value is below 7.0, the elution efficiency is not high. 2) If the final concentration of DNA needs to be increased, the obtained DNA eluent can be added back to the adsorption membrane, left at room temperature for 2-5 minutes, and centrifuged at 12000 rpm for 1 minute. 3) Because DNA stored in water is affected by acidic hydrolysis, if long-term storage is required, it is recommended to elute with Buffer GE and store at -20 ℃... Read More | DescriptionUse in combination with the KitAlysis Bench Top Inertion Box (Z742064) or a glove box/glove bag to provide inert atmosphere for kit set-up.Designed to be used with KitAlysis High-Throughput Screening Kits.Components:24-Well Reaction BlockTorque ScrewdriverSmall screwdriver to easily DescriptionUse in combination with the KitAlysis Bench Top Inertion Box (Z742064) or a glove box/glove bag to provide inert atmosphere for kit set-up.Designed to be used with KitAlysis High-Throughput Screening Kits.Components:24-Well Reaction BlockTorque ScrewdriverSmall screwdriver to easily remove torqued screws after reaction is complete.10 Reaction Block Replacement Screws... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This reagent kit is designed based on the principle that biotin and Streptavidin have a strong affinity. After the primary antibody of rabbit or mouse origin binds to the corresponding target antigen, the biotinylated antibody in this kit • • Rabbit/mouse universal secondary antibody This reagent kit is designed based on the principle that biotin and Streptavidin have a strong affinity. After the primary antibody of rabbit or mouse origin binds to the corresponding target antigen, the biotinylated antibody in this kit • • Rabbit/mouse universal secondary antibody specifically binds to the primary antibody; The biotin labeled on the secondary antibody binds to streptavidin labeled with peroxidase (HRP), forming an antigen-specific primary antibody biotinylated secondary antibody streptavidin complex labeled with HRP. HRP can catalyze substrate colorimetry, thereby inferring the presence and distribution of the tested antigen. The biotinylated secondary antibody and SA-HRP used in this reagent kit all adopt optimized labeling and purification techniques, which make their staining more sensitive and have a lower background. They are suitable for detecting formalin fixed paraffin embedded tissue sections, as well as frozen sections, cell slides, freshly prepared blood smears, etc. The rabbit/mouse universal Streptavidin HRP kit is suitable for use with aladdin ready to use or concentrated antibodies. Composition：Note: This reagent kit is only suitable for IHC experiments where the primary antibody is an immune or mouse derived antibodNotes:1. Add 1 drop (approximately 50) to each slice µ l) Calculation: 3ml can make 60 slices, and 18ml can make 360 slices.2.For tissues with abundant endogenous biotin content, it is best to use endogenous biotin blockers for blocking when using this kit.3. DAB working solution is prepared and used immediately, and the prepared working solution is effective within 1 hour in the dark at 2-8 ° C.4. During the experiment, avoid drying the tissue slices, so the amount of working fluid used during each incubation step must be sufficient to ensure complete coverage of the tissue sample, and incubation should be carried out in a wet box as much as possible.5. To obtain the best experimental results, please make sure to optimize the experimental conditions and reagent dosage.6. DAB is a suspected carcinogen, please take necessary protective measures when using it. 7. This product is only for scientific research and cannot be used for human reactions or treatments.Operation steps：1. Routine processing of samples such as paraffin or frozen tissue sections or cell slides to be tested.1) Preparation for staining of tissue sections or cell slides: a. Dewaxing and hydration of paraffin sections: bake at 60 º C for 1 hour, dewaxing twice with xylene for 5 minutes each time; Then immerse in gradient ethanol (anhydrous ethanol anhydrous ethanol 95% 85% 75% ethanol) and distilled water for 5 minutes each for hydration. b. Frozen sections and cell climbing sections (or climbing sections) were soaked in 0.01 M pH 7.4 PBS and washed 3 times for 5 minutes. Then cover the tissue (or cells) with 0.1% Triton X-100 and infiltrate for 15 minutes. Wash twice with 0.01 M pH 7.4 PBS for 5 minutes.2) Antigen repair of paraffin sections: In most cases, high-pressure repair with citric acid buffer is suitable for paraffin tissue sections. Preparation of repair solution: Add 10 ml of citric acid buffer (IHC antigen repair solution, 100 x) to 1 L of deionized water, and mix well. Repair process: The repair solution is added to a high-pressure cooker, and the repaired slices are immersed in the repair solution (must have no tissue). Cover the pressure cooker cover, heat until evenly sprayed with steam, and start timing from the spraying. After 1-2 minutes, the pressure cooker leaves the heat source and cools naturally to room temperature. Remove the slices, rinse with distilled water, and rinse twice with PBS (0.01 M pH 7.4) for 3 minutes each time.2. Add an appropriate amount of Solution A white solution, which is an endogenous peroxidase blocking solution, and incubate at room temperature for 10 minutes, then rinse thoroughly with PBS.3. Add an appropriate amount of Solution B white solution dropwise, which is sealed with normal sheep serum working solution. Incubate at room temperature for 10 minutes and shake dry.4. Add an appropriate amount of primary antibody working solution (commercial ready to use antibodies or concentrated antibodies diluted in appropriate proportions) dropwise, incubate according to experimental requirements, and then rinse thoroughly with PBS.5. Add an appropriate amount of Solution C yellow solution, namely biotin labeled sheep anti rabbit/mouse secondary antibody working solution, incubate at room temperature for 10 minutes, and rinse thoroughly with PBS.6. Add an appropriate amount of Solution D red solution, which is HRP labeled streptavidin. Incubate at room temperature for 10 minutes and rinse thoroughly with PBS.7. Preparation of DAB color working solution: According to the required amount, mix DAB-A and DAB-B in a volume ratio of 1:19 to obtain DAB color working solution. Alternatively, one drop (approximately 50) can be added per milliliter of reagent B µ l) Reagent A, mix well.8. Color development: Add an appropriate amount of DAB color development working solution to the tissue section or cell slide that needs to be developed, and the color development time is generally 1-5 minutes. Observe and control the color development time under a microscope. When the optimal color development effect is achieved, rinse with tap water to terminate the color development. The colored slices are re stained, dehydrated and transparent, and can be stored for a long time after sealing... Read More |