| Description | Inquire | Products content Box 1: Circularization reagentC666001Component16 TStorageC666001ASplint Oligo20 µL-20℃.Avoid freeze/thaw cycle. C666001B5×Splint Buffer T4250 µL-20℃.Avoid freeze/thaw cycle. C666001CDNA Ligase50 µL-20℃.Avoid freeze/thaw cycle. C666001DDigestion Products content Box 1: Circularization reagentC666001Component16 TStorageC666001ASplint Oligo20 µL-20℃.Avoid freeze/thaw cycle. C666001B5×Splint Buffer T4250 µL-20℃.Avoid freeze/thaw cycle. C666001CDNA Ligase50 µL-20℃.Avoid freeze/thaw cycle. C666001DDigestion Buffer20 µL-20℃.Avoid freeze/thaw cycle. C666001EDigestion Enzyme I70 µL-20℃.Avoid freeze/thaw cycle. C666001FDigestion Enzyme III25 µL-20℃.Avoid freeze/thaw cycle. Box 2: Magnetic Beads for DNA Purification and RecoveryC666001Component16 TStorageC666001GCMPure4×1.5 mL2-8℃Products IntroductionThe Cyclization Kit is a modular kit tailored for the MGI high-throughput sequencing platform. With this kit, PCR products after junction ligation can be prepared into single-stranded circular DNA libraries suitable for MGI sequencers. All reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of library construction. Provide your own instruments, reagents and consumables1. Magnetic frame: DynaMagTM-2 (Cat. No. 12321D) is recommended.2. "Qubit" 3.0 Fluorescence Quantimeter (ThermoFisher, Cat. No. Q33216)3. Qubit" ssDNA Assay Kit (Invitrogen, Cat. No. Q10212)4. Anhydrous ethanol, EB (10 mM Tris-HCl, pH 8.0), NF Water (pH between 7.0 and 8.0).5. reaction tubes: low adsorption PCR tubes with 1.5 mIEP tubes are recommended: 5.Tip: It is recommended to use a high quality filter tip to prevent contamination of kits and libraries. Pre-experiment Preparation and Important Notes 1. Sample preparation.PCR product: 2330 ng total (total amount when multiple PCR products are mixed) in a volume of 49 pL (if the volume of PCR product is insufficient, add NF Water to bring the total volume to 49 pl). -PCR product: Fragment size: The fragment peak is between 200-500 bp. -PCR product fragment size: Fragment peaks between 200-500 bp. -PCR product modification: Fixed sequences (with Index) for MGISEQ-2000, MGISEQ-200 and BGISEQ-500 sequencing platforms were added.2. Reagent preparation-Remove the corresponding reagents from the kit, centrifuge briefly, and place the enzyme mixture on ice until ready to use: buffers need to be dissolved at room temperature before use, then centrifuged with shaking and placed on ice until ready to use, and NF Water and EB are placed at room temperature until ready to use: "Please make up the mixture on ice:Precipitation may appear after the buffer in the kit is dissolved, the precipitation does not affect the function of the reagent, please shake and mix well until the precipitation disappears and then use. Schematic diagram of the cyclization process procedurecyclize 1. 1 wl of Splint Oligo was added to the 49JI PCR product. The product was denatured and incubated on a PCR instrument at 95°C for 3 min, then immediately transferred to an ice bath and allowed to stand for 2 min. 2. The reaction mixture was prepared on ice according to the following system. 3. Add 15ul of the above reaction mixture to 50µl of denatured DNA.4. Place the above PCR tubes on the PCR instrument under the following conditions Reaction. digest 1. Prepare the digestion reaction solution on ice according to the following system. 2. After the cyclization reaction, add 8l of digestion reaction solution directly to the cyclization system, mix well, centrifuge briefly and then place the PCR tube on the PCR instrument and react under the following conditions. 3. Purification was carried out immediately after the reaction.Purification of digestive products1. Remove CMPure at room temperature 30 minutes prior to use and mix well with shaking.2. Transfer the digested product to a 1.5 mIEP tube, pipette 340 pICMPure into the digested product, mix well by gently blowing 10 times with a pipette and incubate for 10 minutes at room temperature.3. Instantaneous centrifugation, place the EP tube on a magnetic rack and let stand for 5 minutes until the liquid is clear, pipette and discard the supernatant.4. Keep the EP tube fixed on a magnetic rack, add 250ul of freshly prepared 80% ethanol, let it stand at room temperature for 1 minute, then carefully discard the supernatant.5. Repeat step 4 once, try to suck up the liquid at the bottom of the tube: Note: Do not suck up the magnetic beads, so as not to affect the yield.6. Keep the EP tube fixed on the magnetic rack, open the cap and dry it at room temperature for 5-10 minutes.7. Remove the EP tube from the magnetic rack, add 35ul of EB or NF Water for DNA elution, pipette blow to mix and dissolve at room temperature for 10 min.8. Centrifuge instantaneously, place the EP tube on a magnetic rack and let stand for 2 minutes until the liquid is clarified, transfer the supernatant to a new EP tube. -Store at 20C and leave to prepare DNB... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This reagent kit uses highly sensitive silver dye, which can be applied to protein staining of denatured and non denatured gels. It has the advantages of clear target bands, low background, and flexible control of operation time. In addition, this reagent kit has added a short-term sensitization This reagent kit uses highly sensitive silver dye, which can be applied to protein staining of denatured and non denatured gels. It has the advantages of clear target bands, low background, and flexible control of operation time. In addition, this reagent kit has added a short-term sensitization step, which can significantly reduce the background and enhance the brightness of the target band. P665901Component20 TStorageP665901ASilver Stain Sensitizer (500×)2×1 mLRTP665901BSilver Stain Enhancer3 mLRTP665901CSilver Stain2×250 mLRTP665901DSilver Stain Developer4×125 mLRT Matters needing attention1. Please prepare 50 ml of fixed solution (ultrapure water: ethanol: acetic acid=6:3:1), 50 ml of eluent (10% ethanol), and 50 ml of termination solution (5% acetic acid) in advance.2. Please use deionized water and clean glass or plastic containers during operation, and wear disposable gloves for operation.The entire silver dyeing process needs to be carried out on a shaker, with a rotation speed of about 60 rpm.4. Self prepared ethanol and glacial acetic acid are required.Instructions for useThe dosage of each solution in the following operation steps takes the gel with a size of 8.5 × 5.5 cm and a thickness of 1.0 mm as an example. The gel is immersed in the solution completely, and is operated on a shaker, with a general dosage of 25 ml. For large gel, the dosage of each solution should be scaled up according to the gel volume. Please prepare 50 ml of fixed solution (ultrapure water: ethanol: glacial acetic acid=6:3:1), 50 ml of eluent (10% ethanol), and 50 ml of termination solution (5% glacial acetic acid) in advance.1. Water washing: After electrophoresis is completed, wash the gel twice with ultrapure water for 5 minutes each time.2. Fixation: Fix the gel twice with 25 ml of fixative solution for 15 minutes each time.3. Elution: Wash the adhesive twice with eluent, each time for 5 minutes.4. Water washing: Wash the glue twice with ultrapure water, each time for 5 minutes.5. Sensitization: put the gel washed in the previous step into the silver dye sensitization working solution, incubate it accurately for 1 minute at room temperature, and then wash it with ultrapure water for three times, each time for 20 seconds. Preparation of silver staining sensitization working solution: Take 50 µ l Silver Stain Sensitivity (500 x) and add it to 25 ml of ultrapure water, mix well.6. Silver staining: discard ultrapure water and incubate gel in silver staining working solution for 30 minutes. Preparation of silver staining working solution: Take 25ml Silver Stain and add 50 µ l Silver Stain Enhanced to mix well.7. Water washing: Quickly wash the glue twice with ultrapure water, with each washing accurately controlled for 20 seconds.8. Development: Immerse the washed gel in the developer immediately and incubate it at room temperature for 2-3 minutes until the protein strip is clear. Preparation of developer: Take 25ml Silver Stain Developer and add 30 µ l Silver Stain Enhanced to mix well. Attention: Within 30 seconds of development, protein bands begin to appear and continue to develop for 2-3 minutes. If the protein band appears lighter, the development time can be appropriately extended to 5 minutes or more.9. Termination: After washing the developer on the gel with the termination solution, soak the gel in a new termination solution to react for 10 minutes.Experimental imagesSilver staining results of BSA protein samples after 10% SDS-PAGE gel electrophoresisThe molecular weight of BSA protein is about 66 kD, and the loading amounts from left to right are 50 ng, 10 ng, and 5 ng, respectively... Read More |