| Description | Inquire | Product content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct IntroductionProduct content:ComponentG665836100 rxnsG665836100 rxnsG665836100 rxns2×GoldStar Probe One Step Buffer1.4 ml1.4 ml1.4 mlGoldStar Probe One Step EnzymeMix100 µl100 µl100 µl50×Low ROX-50 µl-50×High ROX--50 µlRNase-Free Water1.5 ml1.5 ml1.5 mlProduct Introduction：This product is a specialized reagent kit for one-step Real Time RTqPCR using probe methods (TaqMan, Molecular Beacon, etc.). When using this product for Real Time RT qPCR reaction, reverse transcription and quantitative PCR are requiredConducted in the same reaction system, there is no need to add reagents or open the tube cap during the reaction process, avoiding contaminationThis has improved the efficiency of the experiment. This product has high detection sensitivity, strong fluorescence signal, and high signal-to-noise ratio, making it very suitable forDetection of RNA viruses and other trace amounts of RNA. The special buffering system it contains can enable reverse transcriptase to interact with DNA polymeraseMaximize the effectiveness and improve reaction efficiency. By using this product, a wider linear range can be obtained, which is beneficial for the target base Due to more accurate quantification, good repeatability, and high reliability.ROX dye is used to correct the fluorescence signal error generated between wells in quantitative PCR instruments, and is generally used for ABIReal Time PCR amplification equipment from companies such as Stratagene. The excitation optical systems of different instruments vary, thereforeThe concentration of ROX dye must be matched with the corresponding fluorescence quantitative PCR instrument.matters needing attention：1. Before using the reagents in this reagent kit, please gently mix them upside down to avoid foaming as much as possible, and use them after brief centrifugation. 2. This product uses RNA as a template for one-step RT-PCR experiments, and RNase contamination should be avoided during the operation process,2.It is recommended to perform RNA operations in a dedicated area, using specialized instruments and consumables. Operators should wear masks and disposable gloves and frequently change gloves. Experimental consumables should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours and sterilized under high pressure for 30 minutes before use.3. Each reagent in this kit should avoid repeated freezing and thawing as much as possible, as repeated freezing and thawing may lead to a decrease in product performance.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT qPCR reaction. When designing primers, GC content, primer length, and primer should be considered Due to factors such as location, secondary structure of PCR products, it is recommended to use professional primer design software for design.5. It is recommended to use specific probes in this reagent kit and use professional design software for design. Usage: The following examples are typical reaction systems and conditions. In practical operation, corresponding improvements and optimizations should be made based on the differences in template, primer structure, and target fragment size. (Please prepare the reaction solution on ice)1. Dissolve the RNA template, primers, 2xGoldStar Probe One Step Buffer, GoldStar Probe One Step EnzymeMix, and RNase Free Water and place them on ice for later use.2. PCR reaction system: reagent 25 µl Reaction system final concentration 2×GoldStar Probe One Step Buffer 12.5 µl 1× Forward Primer，10 µM 0.5 µl 0.2 µM 1） Reverse Primer，10 µM 0.5 µl 0.2 µM 1） Probe ，10 µM 0.5 µl 0.2 µM 2） GoldStar Probe One Step EnzymeMix 1.0 µl / RNA Template X µl 10 pg – 100 ng3） 50×Low ROX or High ROX （optional）4） 0.5 µl 1× RNase-Free Water up to 25 µl /Note: 1) Typically, the primer concentration is 0.2 µ M can achieve good results, ranging from 0.1 to 1.0 µ M serves as a reference for setting the range. 2) The concentration of the probe used is related to the fluorescent quantitative PCR instrument used, the type of probe, and the type of fluorescent labeling substance. Please refer to the instrument manual or the specific usage requirements of each fluorescent probe for concentration adjustment during actual use.3) The amount of RNA templates is usually based on 10 pg-100 ng as a reference. Due to the different copy numbers of target genes contained in templates of different species, gradient dilution can be applied to the templates to determine the optimal template usage.4) The excitation optical systems of different instruments vary, and depending on the instrument used for fluorescence quantification, 50 x Low ROX or 50 x High ROX can be added.3. Mix well, centrifuge briefly, and collect the solution to the bottom of the tube.4. RT-PCR reaction conditions steps temperature time / Reverse Transcription 45℃ 10 min / PCR pre denaturation 95℃ 10 min / denaturation 95℃ 15s 30-40cycle Annealing/Extension 60℃ 45s 30-40cycleAttention:1) The hot start enzyme used in this product must be activated under pre denaturation conditions of 95 ℃ and 5-10 minutes.2) It is recommended to use a two-step PCR reaction program. If good experimental results cannot be obtained due to the use of primers with lower Tm values, a three-step PCR amplification can be attempted. The annealing temperature should be set within the range of 56 ℃ -64 ℃ as a reference... Read More | Ketone bodies, 3-hydroxybutyric acid (BOH) and acetoacetic acid (AcAc), are produced in the liver primarily from oxidation of fatty acids, and are normally present at low concentrations in urine and blood. Increased ketone concentrations in the blood may lead to metabolic acidosis, which has been Ketone bodies, 3-hydroxybutyric acid (BOH) and acetoacetic acid (AcAc), are produced in the liver primarily from oxidation of fatty acids, and are normally present at low concentrations in urine and blood. Increased ketone concentrations in the blood may lead to metabolic acidosis, which has been associated with diabetes, childhood hypoglycemia, growth hormone deficiency, alcohol or salicylate intoxication, and inborn errors of metabolism.Ketone Body Assay has been used to measure the release of ketone bodies in the human liver cancer cell line HepG2 culture medium... Read More | The miRNA extraction kit is specifically designed to isolate and purify miRNAs from various animal tissues, plant tissues, cells, serum, plasma and other samples. It can also extract small molecule RNAs such as siRNA and snRNA that are less than 200 nt, and can also be used for the extraction of The miRNA extraction kit is specifically designed to isolate and purify miRNAs from various animal tissues, plant tissues, cells, serum, plasma and other samples. It can also extract small molecule RNAs such as siRNA and snRNA that are less than 200 nt, and can also be used for the extraction of total RNA. This product combines phenol/guanidine lysis technology and silicon matrix membrane purification technology. The unique lysis solution can effectively inhibit RNases while removing most of DNA and proteins from cell or tissue samples through organic extraction. For some sensitive downstream experiments, if miRNA enrichment is required, this kit can be used to enrich miRNA separately. This product is suitable for a wide range of samples, with high purity of prepared RNA, and can be directly used for sensitive downstream applications, such as Northern Blot analysis, Real Time PCR, Microarray Analysis, etc. M665531Component50 TStorageM665531ATRIzon Reagent60 mL2-8℃. Protect from ligt.M665531BBuffer RWT (concentrate)15 mLRTM665531CBuffer RW2 (concentrate)11 mLRTM665531DRNase-Free Water10 mLRTM665531ESpin Columns RM with Collection Tubes50 setsRTM665531FSpin Columns RS with Collection Tubes50 setsRTM665531GRNase-Free Centrifuge Tubes (1.5 mL)50 EART Self prepared reagents: chloroform, anhydrous ethanol (newly opened or dedicated for RNA extraction).Preparation and important precautions before the experiment:To prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The extracted samples should avoid repeated freeze-thaw cycles, otherwise it will affect the quantity and quality of miRNA extraction.Before the first use, anhydrous ethanol should be added to Buffer RWT and Buffer RW2 according to the instructions on the reagent bottle label.4. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Operation steps:Protocol A: miRNA enrichment (can be directly used for sensitive downstream experiments)1. Sample processing1a Organization: Grind the organization in liquid nitrogen. Add 1 ml of TRIzon Reagent to every 30-50 mg of tissue, shake and mix well. The sample volume shall not exceed one tenth of the volume of TRIzon Reagent.1b Single layer culture of cells: Remove the culture medium, add TRIzon Reagent, and add 1 ml of TRIzon Reagent every 10 cm2 (the amount of lysis solution depends on the area of the culture bottle).1c Cell suspension: Centrifuge to obtain cell precipitate, discard supernatant. Add 1 ml of TRIzon Reagent to every 5 x 106-1 x 107 cells (cells do not require washing).1d Plasma or serum: Take 200 µ Add 5 times the volume of TRIzon Reagent to plasma or serum samples, shake and mix well for 30 seconds.2. After adding TRIzon Reagent to the sample, blow it repeatedly several times to fully crack it. Leave at room temperature for 5 minutes to completely separate the protein nucleic acid complex.3. Optional steps: Centrifuge at 4 ℃ 12000 rpm (~13400 × g) for 5 minutes, take the supernatant, and transfer it to a new centrifuge tube (provided by oneself) (if the sample contains more proteins, fats, polysaccharides, etc., this step can be performed).4. Add chloroform to the supernatant and add 200 to every 1 ml of TRIzon Reagent used µ Chloroform, cover the tube, vigorously shake for 15 seconds, and let it sit at room temperature for 5 minutes.Centrifuge at 5.4 ℃ and 12000 rpm for 15 minutes. The sample is divided into three layers: red organic phase, middle layer, and colorless aqueous phase. Transfer the upper colorless aqueous phase to a new centrifuge tube (self prepared).6. Add 1/3 volume of anhydrous ethanol to the solution obtained in step 5, mix well, and transfer the obtained solution and precipitate together into the adsorption column RM (Spin Columns RM) that has been loaded into the collection tube. If you cannot add all the solution to the adsorption column at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the adsorption column RM after centrifugation, and retain the effluent.7. Add 2/3 times the volume of anhydrous ethanol to the solution obtained in step 6 and mix well.8. Transfer the solution and precipitate obtained from the previous step into the adsorption column RS (Spin Columns RS) that has been loaded into the collection tube. If you cannot add all the solution to the adsorption column at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.9. Add 700 to the adsorption column RS µ L Buffer RWT (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.10. Add 500 to the adsorption column RS µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RS back into the collection tube.11. Repeat step 10.12. Centrifuge at 12000 rpm for 1 minute and discard the waste liquid from the collection tube. Place the adsorption column RS at room temperature for a few minutes to thoroughly air dry. Note: The purpose of this step is to remove residual ethanol from the adsorption column RS, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column RS in a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store the obtained RNA solution at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 13 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column RS and repeat step 13Protocol B: Extraction of total RNA (including miRNA and other small molecule RNAs<200 nt), steps 1-5 are the same as protocol A.6. Add 1.25 times the volume of anhydrous ethanol to the solution obtained in step 5 and mix well.7. Transfer the solution and precipitate obtained from the previous step into the spin columns RM that have been loaded into the collection tube. If you cannot add all the solution to the adsorption column RM at once, please transfer it multiple times. Centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.8. Add 700 to the adsorption column RM µ L Buffer RWT (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.9. Add 500 to the adsorption column RM µ Buffer RW2 (check if anhydrous ethanol is added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the collection tube.10. Repeat step 9.11. Centrifuge at 12000 rpm for 1 minute and discard the waste liquid from the collection tube. Place the adsorption column RM at room temperature for a few minutes to thoroughly air dry. Attention: The purpose of this step is to remove residual ethanol from the adsorption column RM, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).12. Transfer the adsorption column RM into a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store the obtained RNA solution at -70 ℃ to prevent degradation. Attention: 1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 12 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column RM and repeat step 12... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |