| Description | Inquire | When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in When apoptosis occurs, some DNA endonucleases will be activated. These endonucleases will cut off genomic DNA between nucleosomes and produce 180 bp-200 BP DNA fragments, which appear as a specific ladder pattern in agarose gel electrophoresis. When double strand or single strand breaks occur in genomic DNA, a large number of sticky 3'-oh ends will be generated, which can interact with YF under the catalysis of deoxyribonucleotide terminal transferase (TDT) ®/ CY dUTP binding can directly detect apoptotic cells by fluorescence microscopy or flow cytometry. This kind of method is called terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL). Because normal or proliferating cells have almost no DNA breaks, there is no 3'-oh formation and they can rarely be stained. TUNEL method can stain intact single apoptotic nuclei or apoptotic bodies in situ, can accurately reflect the typical biochemical and morphological characteristics of apoptosis, and can detect a very small number of apoptotic cells, so it is widely used in the study of apoptosis. This kit has a wide range of applications and can be used to detect apoptosis in frozen or paraffin sections, as well as cultured adherent cells or suspended cells. It can selectively detect apoptotic cells, but not necrotic cells or cells with DNA strand breaks caused by irradiation and drug treatment. This kit detects cell apoptosis with a short time-consuming, one-step staining reaction and can be detected after washing.Composition: Composition 20T 50T A. aladdin®640 TUNEL Reaction Buffer 1 mL 2 ×1.25 mL B. TdT Enzyme 20 µL 50 µL C. Proteinase K (2 mg/mL) 40 µL 100 µL D. DNase I (2 U/µL) 5 µL 13 µL E. 10 ×DNase I Buffer 100 µL 260 µL Product parameters:642/662 nm; Instruction: Experimental materials (self provided)PBS buffer (1 x, pH~7.4). 0.2% Triton X -100 (PBS formulation). 0.1% Triton X -100 (PBS formulation, containing 5 mg/mLBSA)4% paraformaldehyde (prepared with PBS)Immunohistochemical penDewaxing solvent (paraffin section sample)Related reagents for paraffin section processingAnti fluorescence quenching and sealing agent. ddH2Oexperimental design. A. Positive control:Prepare positive control slides using DNaseI treatment. DNaseI can digest single or double stranded DNA and expose the 3 '- OH end, artificially causing cell apoptosis. One experiment per time is sufficient. (To verify if there are any issues with the experimental operation and reagent kit)B. Negative control:Use TUNEL Reaction Buffer without TdT Enzyme and replace TdT Enzyme with ddH2O. (Mainly to exclude non-specific staining caused by cell apoptosis, operational processes, and other reasons; and to adjust the exposure intensity of the shooting.)C. Experimental processing group.The experimental group operated normally according to the instructions.D. Experimental control group.The experimental group operated normally according to the instructions.Experimental steps1. Sample preparation:(1) For adherent cells or cell smearsa. Clean once with PBS.Note: If you are concerned that the cells on the cell smear may not adhere firmly, you can dry the sample to make the cells adhere more firmly.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at 4 ℃ for 30 minutes. Clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Clean twice with PBS.d. Step 2: TUNEL reaction.(2) For suspended cells or cell suspensionsa. Collect cells (3-5 x 106 cells), centrifuge at 1000 rpm for 5 minutes, and wash twice with PBS.b. Fixation: Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and resuspend the cells thoroughly. Fix at 4 ℃ for 30 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.c. Translucency: Add an appropriate amount of 0.2% Triton X -100 (prepared with PBS) and let it penetrate at room temperature for 20 minutes. Centrifuge at 2000 rpm for 5 minutes and clean twice with PBS.d. Step 2: TUNEL reaction.(3) Paraffin tissue sectioninga. Dewaxing and hydration: Place the sliced samples sequentially in xylene I (10 min) → xylene II (10 min) → 100% ethanol I (5 min) → 100% ethanol II (5 min) → 95% ethanol (5 min) → 90% ethanol (5 min) → 80% ethanol (5 min) → 70% ethanol (5 min) → ddH2O rinse for 5 min, rinse twice.Note: Xylene is toxic and volatile. Please perform this operation in a fume hood.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(4) Frozen tissue sectionsa. Fixation: Take out frozen sections and warm them back to room temperature. Add an appropriate amount of 4% paraformaldehyde (prepared with PBS) and fix at room temperature for 30 minutes. Wash twice with PBS for 10 minutes each time.Note: If you are concerned that formaldehyde cleaning may not be clean enough, it may affect the final dyeing effect. After formaldehyde fixation is completed, an appropriate amount of 2 mg/mL glycine can be added and washed for 10 minutes to neutralize the residual fixing solution, and then PBS cleaning can be carried out.b. Use filter paper to dry the liquid around the sliced sample, and circle the sample contour with an immunohistochemical pen for downstream transparency and labeling.Note: If it is found that the contour circle of immunohistochemistry strokes is damaged in subsequent experimental operations, it needs to be redrawn in a timely manner.c. Transparency: Dilute 2 mg/mL of ProteinaseK solution with PBS in a ratio of 1:100 to a final concentration of 20 µ g/mL. Add 100 µ L dropwise to each sample to cover all sample areas. Incubate at 20-37 ℃ for 20 minutes.Note: Protein K can penetrate the cell membrane and nuclear membrane, allowing subsequent staining reagents to fully enter the nucleus for reaction and improve labeling efficiency. An excessively long incubation time increases the risk of tissue slices falling off the carrier film during subsequent washing steps, while a too short incubation time may result in insufficient permeability treatment and affect labeling efficiency. To obtain better results, the concentration, incubation time, and temperature of Protein K need to be optimized according to different types of tissue samples.d. Wash the slices twice with PBS, each time for 5 minutes. Use filter paper to remove excess liquid, and place the processed sample in a wet box to keep it moist.Note: Protein K must be washed thoroughly in this step, otherwise it will seriously interfere with subsequent labeling reactions.e. Step 2: TUNEL reaction.(5) Positive treatment (only the positive control is subjected to this step, and other samples are directly subjected to the TUNEL reaction step)a. Dilute 10 x DNase I Buffer with ddH2O in a ratio of 1:10 to 1 x DNase I Buffer for later use.b. Drip 100 µ L of 1xDNase I Buffer onto the processed sample, covering all sample areas, and equilibrate at room temperature for 5 minutes.c. Dilute DNase I (2 U) with 1 x DNase I Buffer at a ratio of 1:100/ µ L) A working solution with a final concentration of 20 U/mL.d. Discard the buffer and add 100 µ Incubate DNase I working solution with a concentration of 20 U/mL at room temperature for 10 minutes.e. Discard DNase I working solution and clean twice with PBS.f. Step 2: TUNEL reaction.2. TUNEL reaction(1) Prepare TUNEL reaction solution (ready to use): / 1 sample 5 sample 10 sample TdT enzyme 1 µL 5 µL 10 µL YF®488/555/594/640 TUNEL Reaction Buffer 49 µL 245 µL 490 µL TUNEL Total volume of reaction solution 50 µL 250 µL 500 µL (2) For adherent cells, cell smears, or tissue sectionsa. Add 50 to each sample µ L TUNEL reaction solution, evenly cover the sample with the reaction solution. The appropriate time for dark incubation at 37 ℃ (recommended staining time for cells is 30 minutes to 1 hour, and tissue staining time is 2 hours).Note: 50 µ L TUNEL reaction solution is suitable for smear, slicing, or 96 well plates (other different well plates can adjust the volume of TUNEL reaction solution appropriately to cover cells). If the sample to be tested is a smear, slice, or in a 24 well plate, 12 well plate, or 6 well plate, anti evaporation film can be used, or self sealing bags or other appropriate materials can be used to cut circular plastic sheets slightly smaller than the holes. After adding TUNEL reaction solution dropwise, cover the sample to prevent the evaporation of TUNEL reaction solution and make the TUNEL reaction solution evenly cover the sample.b. Discard the TUNEL reaction solution, wash twice with PBS, and then wash three times with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mL BSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. (Optional) Add an appropriate concentration of 5 to each sample µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes. After staining, discard DAPI staining solution and wash twice with PBS for 5 minutes each time.d. (Optional) Slice sealing: Add 50 drops to each sample µ L anti fluorescence quenching sealing agent (anti fluorescence quenching sealing agent may not be suitable for certain dyes, it is recommended to conduct pre experimental testing for compatibility before the experiment), cover the cover glass, gently tap the cover glass with the blunt end of tweezers to remove bubbles and ensure complete sealing.e. Use filter paper to remove excess liquid and add 100 to the sample area µ Keep the sample moist with PBS and immediately observe under a fluorescence microscope.(3) For suspended cells or cell suspensionsa. Add 50 to each sample tube µ Gently resuspend cells in LTUNEL reaction solution and incubate at 37 ℃ in the dark for 30-1 hour. Gently resuspend cells with a micropipette every 15 minutes.b. Centrifuge at 2000 rpm for 5 minutes, discard TUNEL reaction solution, and wash twice with 0.1% Triton X -100 (PBS preparation, containing 5 mg/mLBSA) for 5 minutes each time. This way, free unreacted markers can be removed cleanly.c. Add 100 to each sample tube µ L concentration is 5 µ DAPI staining solution with a concentration of g/mL, incubated at room temperature in dark for 5 minutes.d. Join 400 µ L PBS resuspended cells and immediately detected with a flow cytometer or observed under a fluorescence microscope after smearing.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. when the staining background is heavy or non-specific staining is obvious, the staining time can be appropriately reduced. 3. it is recommended to add negative control and positive control groups during the experiment. 4. please wear mask and gloves when using component A. if it contacts the skin, please wash it with plenty of water immediately. 5. fluorescent dyes have quenching problems. Please try to avoid light to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application:Late apoptosis detection, TUNEL Kit... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This kit is suitable for extracting total RNA from fresh whole blood (blood samples treated with anticoagulants such as citrate, EDTA, or heparin). It can process up to 1.5 ml of whole blood and elute to obtain high-purity RNA with a molecular weight greater than 200 bp. Multiple samples can be This kit is suitable for extracting total RNA from fresh whole blood (blood samples treated with anticoagulants such as citrate, EDTA, or heparin). It can process up to 1.5 ml of whole blood and elute to obtain high-purity RNA with a molecular weight greater than 200 bp. Multiple samples can be completed simultaneously within 1 hour. This product does not require the ultra centrifugation step of CsCl purification and LiCl or ethanol precipitation. It does not contain toxic solvents such as phenol or chloroform. The purified RNA effectively removes enzyme inhibitors and pollutants such as heme and heparin. It can be directly used in various molecular biology routine experiments, such as RT-PCR, Northern Blot, Dot Blot, in vitro translation, and so on.Self prepared reagents: β- Mercaptoethanol, 70% ethanol (prepared with water without RNase), anhydrous ethanol. R666034 Component 50 T Storage R666034A Buffer RBL (10×) 60 mL RT R666034B Buffer RL 35 mL RT R666034C Buffer RW1 40 mL RT R666034D Buffer RW2 (concentrate) 11 mL RT R666034E RNase-Free Water 10 mL RT R666034F Spin Columns FL with Collection Tubes 50 sets RT R666034G Spin Columns RM with Collection Tubes 50 sets RT R666034H RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RT Preparation and important precautions before the experimentTo prevent RNase pollution, attention should be paid to the following aspects:1) Use RNase free plastic products and gun heads to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) Prepare the solution using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The sample should avoid repeated freezing and thawing, otherwise it will affect the yield and quality of RNA extraction. The sample can be stored in Buffer RL at -70 ℃ for one month.3. Before use, please check if there is any crystallization or precipitation in the Buffer RL. It can be dissolved again in a 56 ℃ water bath. Please add Buffer RL before use β- Mercaptoethanol, with a final concentration of 1%. Add 10 to 1 ml Buffer RL µ L β- Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month.4. Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. This reagent kit cannot be used for RNA extraction from frozen blood samples with anticoagulants added.6.10 × Buffer RBL needs to be diluted 10 times with water without RNase before use, and then stored at 2-8 ℃ after dilution.7. If downstream experiments are highly sensitive to DNA, it is recommended to treat RNA with DNase I that does not contain RNase.8. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Operation steps1. Add 5 times the volume of 1 x Buffer RBL to fresh anticoagulant whole blood samples of 0.5-1.5 ml (please dilute 10 x Buffer RBL with RNase free water before use), gently vortex or invert and mix well. Incubate on ice for 10-15 minutes, mix twice during the incubation process.Attention: During the incubation process, the cloudy suspension will become transparent, indicating that red blood cells have been lysed. If necessary, the incubation time can be extended to 20 minutes. 2. Centrifuge at 4 ℃, 2100 rpm (~400 × g) for 10 minutes, and carefully discard the supernatant.3. Add 2 times the volume of the blood sample to the above precipitate with 1 x Buffer RBL (please dilute 10 x Buffer RBL with RNase free water before use), gently vortex, and resuspend the precipitate thoroughly. 4. Centrifuge at 4 ℃ and 2100 rpm for 10 minutes, carefully and thoroughly remove the supernatant.Note: This step must completely remove the supernatant, otherwise it will affect the lysis and lead to a decrease in RNA production.5. Add Buffer RL to the precipitate (check if it has been added before use β- Mercaptoethanol, 0.5-1.5 ml of blood sample added to 600 µ L Buffer RL, or less than 0.5 ml of blood sample added to 350 µ L Buffer RL, mix well.6. Transfer the obtained liquid to the spin columns FL that have been loaded into the collection tube, centrifuge at 12000 rpm (~13400 × g) for 2 minutes, collect the filtrate, and discard the filter column.7. Add 1 volume (600) to the obtained filtrate µ L or 350 µ l) Mix 70% ethanol (prepared without RNase water) well.Attention: Adding ethanol may cause precipitation and will not affect subsequent experiments.8. Add all the solution obtained in the previous step to the spin columns RM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred in multiple batches. Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.9. Add 700 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.Optional steps: If conducting RNA experiments that are highly sensitive to trace amounts of DNA, replace step 9 with the following steps.1) Add 350 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.2) Preparation of DNase I mixture: Take 70 µ Reaction Buffer and 10 µ L DNase I storage solution, gently mix and prepare to a final volume of 80 µ The reaction solution of L.Attention: The above system is configured according to our company's DNase I (D665537) reaction system. Please refer to the corresponding manual for other company products.1) Add 350 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.2) Preparation of DNase I mixture: Take 70 µ Reaction Buffer and 10 µ L DNase I storage solution, gently mix and prepare to a final volume of 80 µ The reaction solution of L.Attention: The above system is configured according to our company's DNase I (D665537) reaction system. Please refer to the corresponding manual for other company products.3) Add 80 µ l of the prepared DNase I reaction solution directly to the adsorption column and incubate at 20-30 ℃ for 15 minutes.4) Add 350 to the adsorption column µ Centrifuge at 12000 rpm for 15 seconds, discard the waste liquid from the collection tube, and place the adsorption column back into the collection tube.10. Add 500 to the adsorption column µ Buffer RW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 15 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.11. Repeat step 10. 12. Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column in a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 13 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 13... Read More |