| Description | Inquire | Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '-Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '- deoxyuridine) is a pyrimidine analog that integrates into the DNA duplex during DNA synthesis. Edu detection is based on the "click" reaction. A copper catalyzed azide reacts covalently with alkynes to form covalent bonds. In this kit, edu contains alkynes, Aladdin ® 488 / 555/594/647a azide dyes contain azide compounds. The edu labeling proliferation of click method is rapid and effective, and easy to use. BrdU method requires DNA denaturation (such as acid denaturation, thermal denaturation or digestion with DNase) to expose BrdU, so as to facilitate BrdU antibody binding; The edu method only needs paraformaldehyde fixation and Triton X-100 penetration to make the detection reagent enter the cells, and only a small amount of azide dye is needed to label the integrated edu very effectively. This kit contains all components required for edu method detection, and can be used for proliferation detection of cultured cells in vitro. Component：Product parameters： 590/617 nm Instruction：Experimental materials (self provided). 10 mM PBS, pH 7.2-7.6. 4% paraformaldehyde fixing solution (in PBS)Propensive reagent (0.5% Triton X -100 in PBS). 2 mg/mL glycine solution (in ddH2O). 3% BSA in PBS, pH 7.2-7.6. 1% BSA in PBS, pH 7.2-7.6. ddH2O. 96/24/12/6 well culture plate or dishFluorescence microscopy detection method1. Cell cultureTake logarithmic growth stage cells and inoculate them into a 96 well plate with 4 × 103-1 × 105 cells per well (the number and density of cells can be adjusted according to cell size, growth rate, and specific requirements of experimental treatment), and culture until normal growth stage.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU marking(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to incubation time,Short term incubation (<2 hours) should use high concentrations, such as 10-50 µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash the cells twice with a 3% BSA washing solution after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, remove the culture medium. Wash cells twice with 1X PBS for 5 minutes each time to remove EdU residues that have not been incorporated into DNA. Cells with weak adhesion can reduce cleaning intensity. Join 50 µ After incubating at room temperature for 20 minutes with 4% paraformaldehyde fixative, remove the fixative.(2) Add 50 to each hole µ L 2 mg/mL glycine solution, incubate at room temperature for 5 minutes, and neutralize the remaining fixed solution.(3) At a rate of 100 per hole µ Wash cells twice with 3% BSA.(4) Remove the washing solution and add 100 µ L 0.5% Triton X -100, incubate at room temperature for 10 minutes.5. EdU detectionNote: Each sample in this reference step uses 100 µ The working fluid of L can be adjusted by users according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer (component C): Dilute component C 10 times with ddH2O.(2) Configure 5 x Click iT EdU buffer additives (component E): add 300 µ Mix L of ddH2O into a 30 mg E component tube (final concentration of 100 mg/mL) until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio, and prepared into a 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 1.Table 1 Click it working fluid Reaction components Taking the sample size of 10 holes as an example 1 x Click it EdU reaction buffer 855 µL CuSO4 (component D) 40 µL YF® 488/555/594/647A Azide(Component B) 5 µL 1 x Click it EdU buffer additive 100 µL Total volume 1 mL (5) Remove penetration enhancer, 100 per well µ Wash twice with 3% BSA washing solution of L.(6) Add 100 to each hole µ L Click iT working solution, evenly covering cells.(7) Incubate at room temperature in dark for 30 minutes.(8) Remove Click-iT working fluid and add 100 µ After washing cells twice with 3% BSA, remove the washing solution and add 100 µ L PBS keeps cells moist. If there are no other special requirements, photography analysis can be carried out.6. DNA re staining (optional)(1) Using 100 µ Wash the cells once with PBS and remove the washing solution.(2) Dilute Hoechst 33342 (component F) 2000 times with PBS.(3) Add 100 to each hole µ Incubate L 1 x Hoechst 33342 solution at room temperature in dark for 15-30 minutes.(4) Remove Hoechst 33342 solution and use 100 µ Wash cells twice with PBS.7. Imaging and analysisIt is recommended to take fluorescence microscopy photos immediately after staining is completed for observation; If conditions permit, please store in a dark and moist environment at 4 ° C for 3 days before taking photos. Flow cytometry detection method1. Cell cultureInoculate 1 × 105~3 × 106 cells per well into a 6-well plate.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU labeled cells(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours. The time of EdU incubation of cells can be directly used as an indicator for measuring cell DNA synthesis, and the choice of time point and incubation time depend on the cell growth rate. Pulse labeled cells incubated with brief EdU can be used to study cell cycle dynamics.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to the incubation time, and high concentrations, such as 10-50, should be used for short-term incubation (<2 hours) µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash cells twice with 1% BSA after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, collect cells, add 1 mL of PBS to each tube to clean the cells, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant to remove EdU residue that has not been added to DNA.(2) Add 1 mL of 4% paraformaldehyde fixative to each tube to resuspend cells.(3) Incubate at room temperature for 20 minutes, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(4) Add 1 mL of 2 mg/mL glycine to each tube and incubate for 5 minutes. Neutralize the remaining fixed solution, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant. Add 1 mL of PBS to each tube for cleaning once, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(5) Add 1mL of 0.5% Triton X-100 osmotic enhancer to each tube and resuspend cells. Incubate at room temperature for 10 minutes.5. EdU detectionNote: For 6-well plate samples, reference can be made to 1 mL of working solution per well. Users can adjust the dosage according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer: Dilute component C 10 times with ddH2O.(2) Prepare 5 x Click iT EdU buffer additives (component E): Add 300 µ L ddH2O to 30 mg of component E in a test tube (final concentration 100 mg/mL), mix well until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio to form 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive storage solution with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 2.Table 2 Click it working fluid Reaction components Volume of liquid required for a single reaction 1×Click-iT EdU reaction buffer 875 µL CuSO4 (component D) 20 µL YF® 488/555/594/647A Azide(Component B) 5 µL 1×Click-iT EdU buffer additive 100 µL Total volume 1 mL (5) Soak at 1000 rpm for 5 minutes, discard the supernatant, remove the enhancer, add 1mL of 1% BSA washing solution to each tube and wash twice. Soak at 1000 rpm for 5 minutes, discard the supernatant.(6) Add 1 mL of Click iT working solution to each tube and mix well.(7) Incubate at room temperature in dark for 30 minutes.(8) Soak at 1000 rpm for 5 minutes, discard the staining reaction solution, add 1% BSA to each tube to wash the cells twice, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells again with 1 mL of 1% BSA (the volume of resuspend cells can be adjusted according to the number of cells), and detect with a flow cytometer.Note: If other biomarker tests are required, please refer to step 4.6. Intracellular antigen labeling (optional steps)(1) Add antibody working solution and mix well.(2) Under dark conditions, incubate antibodies at appropriate temperature and time.7. Flow detection and analysis:(1) It is recommended to conduct flow cytometry testing immediately after dyeing is completed; If conditions are limited, please store in a dark place at 4 ℃ for testing, but it should not exceed 3 days.(2) It is recommended to test the number of cells up to one million levels as much as possible. If the number of cells is small, the number of cells tested can be adjusted to 100000 levels starting from the experiment. For cases where the cell yield is too low (just to the level of ten thousand), it may not be conducive to making a flow chart. Therefore, the cleaning frequency in step 5 (8) can be appropriately reduced.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. fluorescent dyes have quenching problems. Please try to avoid light during experimental operation to slow down fluorescence quenching. 3. click it edu buffer additive solution should be prepared and used immediately to ensure the best results. 4. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Cell proliferation detection (cell imaging flow universal)... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes V669947 Component 50T Storage V669947A Buffer GL 15 mL RT V669947B Buffer GW1 (concentrate) 13 mL RT V669947C Buffer GW2 (concentrate) 15 mL RT V669947D Buffer RE 10 mL RT V669947E Proteinase K 12.5 mg RT V669947F Proteinase K Storage Buffer 1.25 mL RT V669947G Spin Columns RS with Collection Tubes 50 RT V669947H RNase-Free Centrifuge Tubes (1.5 mL) 50 RTProductsThis kit is suitable for the extraction of viral RNA and DNA from fresh or frozen plasma, serum and cell-free body fluids. It is easy to operate as it does not require the use of organic solvents such as phenol and chloroform for extraction. The kit uses a unique buffer system to enable efficient and specific binding of viral nucleic acids in lysate to silica gel centrifugal adsorption columns. Inhibitors of PCR and enzyme reactions as well as residual impurities can be efficiently removed in a two-step effective rinsing step, and finally high purity viral nucleic acids can be obtained by using a low-salt buffer or water for elution. The purified viral nucleic acid is free of protein, nuclease and other impurities, and can be used directly in PCR, RT-PCR, Real-Time PCR, blotting experiments and so on.Self-contained reagent: anhydrous ethanol.Pre-experiment and Important Notes1. Add 1.25ml Proteinase K Storage Buffer to Proteinase K to dissolve it and store it at -20℃. Do not leave the prepared Proteinase K at room temperature for a long time, and avoid repeated freezing and thawing to avoid affecting its activity. Do not add Proteinase K directly into Buffer GL.2. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller DNA fragments and a decrease in the amount of extracted DNA.3. Avoid repeated freezing and thawing of serum or plasma, which can lead to protein denaturation or precipitation, reducing the viral titer and thus affecting the yield of extracted viral nucleic acids.4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the label instructions of the reagent bottle before first use.5. Check Buffer GL for crystallization or precipitation before use. If crystallization or precipitation occurs, redissolve Buffer GL in a water bath at 56℃.Procedure1. Take a 1.5 ml centrifuge tube (self-provided) and add 20 µl Proteinase K.2. Add 200 µl serum or plasma to the centrifuge tube. Add 200µl Buffer GL and vortex and shake for 15 seconds.Note: 1) Sample volume less than 200 µl can be made up by adding 0.9% NaCl (self-provided). 2) In order to ensure effective lysis of the sample, the sample needs to be mixed well with Buffer GL after adding Buffer GL.3. Incubate at 56°C for 15 minutes, centrifuge briefly, and collect the solution from the wall of the tube to the bottom of the tube.4. 250 µl of anhydrous ethanol was added, vortexed and shaken for 15 seconds, left at room temperature for 5 minutes, centrifuged briefly, and the solution on the wall of the tube was collected at the bottom of the tube.Note: If the ambient temperature exceeds 25°C, anhydrous ethanol should be used after pre-cooling on ice.5. Add the solution obtained in step 4 to the adsorbent column (RNase-Free Columns RS) that has been loaded into the collection tube, and if the solution cannot be added at one time, it can be transferred in several times. centrifuge the column at 12,000 rpm (~13,400 × g) for 1 min, pour off the waste liquid in the collection tube, and put the column back into the collection tube.6. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 7 can be repeated if further DNA purity is required.8. Add 500 µl of anhydrous ethanol to the adsorbent column and centrifuge at 12,000 rpm for 1 min. Pour off the waste liquid in the collection tube and put the adsorbent column back into the collection tube.9. Centrifuge at 12,000 rpm for 3 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is the removal of residual ethanol from the adsorbent column; ethanol residue can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).10. Place the adsorption column in a new collection tube (RNase-Free Centrifuge Tube), add 20-150 µl of Buffer RE or sterilized water overhanging the middle of the adsorption column membrane, leave it at room temperature for 2-5 minutes, and then centrifuge it at 12,000 rpm for 1 minute to collect the nucleic acid solution.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on the elution efficiency, if water is used as the eluent it should be ensured that its pH is 7.0-8.5 (the pH of water can be adjusted to this range with NaOH), and the elution efficiency is not high when the pH is lower than 7.0.(2) For long-term storage, please store the DNA solution at -20℃ and the RNA solution at -70℃.3) If the final concentration of DNA/RNA is to be increased, the DNA/RNA eluate obtained in step 10 can be re-spiked onto the adsorbent membrane and step 10 repeated... Read More |