| Description | Inquire | DescriptionTruQuant IQQ is a high-quality quantitation system for making simultaneous accurate biological measurements on several hundred biochemicals in small quantities of biological samples. This is achieved by (1) spiking a complex Internal Standard (WORKFLOW-A) into a biological sample to a) DescriptionTruQuant IQQ is a high-quality quantitation system for making simultaneous accurate biological measurements on several hundred biochemicals in small quantities of biological samples. This is achieved by (1) spiking a complex Internal Standard (WORKFLOW-A) into a biological sample to a) quantify all the biochemicals in the sample relative to their counterparts in the Internal Standard, b) suppression-correct each compound and c) normalize sample to sample variances; and (2) injecting the same well characterized Long-Term Reference Standard (WORKFLOW-B) to create a daily retention time (RT) library of all compounds to be found in the Internal Standard for reproducible ID, and to measure day-to-day (QA/QC) to assure reproducible instrument performance. The system is completely automated using IROA ClusterFinder™software.IROA TruQuant IQQ Workflow Kit contains the materials and tools for the analysis of 90 experimental samples. The kit is intended to be used for mass spectrometry metabolomics applications... Read More | Live & deadtm animal cell viability / toxicity detection kit (calcein am, ethd-i) is a kit that provides double fluorescent staining for the detection of animal cell death and survival. The two probes in the kit can respectively measure the activity of cellular lactonase and the integrity of Live & deadtm animal cell viability / toxicity detection kit (calcein am, ethd-i) is a kit that provides double fluorescent staining for the detection of animal cell death and survival. The two probes in the kit can respectively measure the activity of cellular lactonase and the integrity of plasma membrane to reflect cell viability. The kit can be used for fluorescence microscopy, flow cytometry, microplate reader and other fluorescence detection systems. This kit can be applied to most eukarYOtic mammalian cells, including some tissues with adherent nuclei, but it is not applicable to fungi and yeast. Compared with trypan blue, the kit is faster, safer and more sensitive.Component: Product parameters:Calcein am: ex/em = 494 / 517 nm; Ethd-i: ex/em = 528 / 617 nm (bound DNA)Usage:Fluorescence microscopy detection1. Prepare working fluidPreparation 2 µ M Calcein AM and 4 µ M EthD-I staining solution: Remove the original solution of Calcein AM and EthD-I and restore them to room temperature. Add 20 µ L 2 mM EthD-I and 5 µ Mix 4 mM Calcein AM with 10 mL PBS or other serum-free buffer or culture medium, vortex well. The above working solution can be directly used for cell staining.Note: The aqueous solution of Calcein AM is easily hydrolyzed and should be used up every day. The concentration selection of Calcein AM and EthD-I varies depending on the type of cell used, with a recommended concentration range of 0.1-10 µ M.2. Prepare cells and conduct experiments(1) For adherent cells, they can be washed 2-3 times with 1 × PBS before staining. For suspended cells, centrifuge at room temperature of 250-1000 × g for 5 minutes and collect cells for staining.(2) Wash the cells thoroughly 2-3 times with 1 × PBS to remove residual esterase activity.(3) For adherent cells, add sufficient amount of Calcein AM/EthD-I staining solution. For suspended cells, add an appropriate amount of staining solution to control the cell density between 1-5 × 105/mL.(4) Incubate at room temperature in dark for 15-20 minutes (if the working solution concentration is high or the incubation temperature is high, the incubation time should be appropriately reduced).(5) Observe the labeled cells under a fluorescence microscope.Flow cytometry detection1. Remove the reagent and restore it to room temperature.2. Preparation 2 µ M Calcein AM and 4 µ M EthD-I staining solution: Take out the original solution of Calcein AM and EthD-I, and restore to room temperature. Add 20 µ L 2 mMEthD-I and 5 µ Vortex mix 4 mM Calcein AM with 10 mL PBS or other serum-free buffer or culture medium. The working fluid can directly stain cells.3. Wash cells thoroughly 2-3 times with 1 × PBS.4. Suspend cells with 0.5 mL of staining solution and control the cell density to 1-5 × 105/mL.Note: It is recommended to prepare two additional cell samples, each containing only one dye (Calcein AM and EthD-I), for compensatory regulation of flow cytometry single staining; Prepare another cell sample containing only buffer solution (which should be consistent with the buffer used to prepare Calcein AM and EthD-I detection working solutions) as a negative control for flow cytometry analysis.5. Incubate at room temperature in dark for 15-20 minutes.6. Within 1-2 hours, cell activity was detected by flow cytometry. Calcein AM can be excited by a 488 nm laser, with fluorescence emission spectra detected at around 530 nm and EthD-I emission spectra at around 610 nm.Note: When using the cell circle gate, attention should be paid to excluding cell debris and using a single staining tube to regulate compensation. Double staining tube flow cytometry should obtain two relatively independent cell populations: a live cell population displaying green fluorescence and a dead cell population displaying red fluorescence.ELISA reader detection1. Cultivate an appropriate amount of adherent or suspended cells in a 96 well black ELISA plate.Note: Dead cells can be obtained by treating cells with 1% saponin or 0.1-0.5% digitalis saponin for 10 minutes.2. Preparation 2 µ M Calcein AM and 4 µ M EthD-I staining solution:Remove the original solutions of Calcein AM and EthD-I and restore them to room temperature. Add 20 µ L 2 mM EthD-I and 5 µ Mix 4 mM Calcein AM 10 mL PBS or other serum-free buffer or culture medium, vortex well.Note: (1) 10 mL of staining solution is sufficient to stain a 96 well plate, and the volume of the staining solution can be adjusted according to experimental needs. The concentrations of Calcein AM and EthD-I can range from 0.1 to 10 µ Explore between M.(2) The aqueous solution of Calcein AM is easily hydrolyzed and should be used up every day. EthD-I working solution can be stored at -20 ℃ for at least one year.3. Wash the cells thoroughly with 1 × PBS to remove residual esterase activity. For adherent cells, add 100 to each well µ Wash cells with PBS. For suspended cells, add 100 µ Resuspend cells with L PBS and centrifuge to remove the supernatant. Repeat the above operation.4. Add 100 to each hole µ L PBS.5. Add 100 to each hole µ L staining solution, making the total volume of each well 200 µ L. The final concentration of Calcein AM is 1 µ M. The final concentration of EthD-I is 2 µ M. Gently shake the culture plate to evenly cover the cells with the liquid.Incubate at room temperature in dark for 30-45 minutes.Note: The optimal incubation time varies for different cells, with 30 minutes as the initial incubation time. Subsequently, the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect.7. Enzyme reader detection. When the ELISA reader is set to fluorescein, it can detect Calcein AM; When the ELISA reader is set to rhodamine or Texas Red, EthD-I can be detected. Select the optimal emission and excitation wavelengths based on spectral characteristics.Note: By comparing the relative fluorescence values (RFU) measured between the sample group and the control group, the changes in the number of dead and live cells can be obtained. Another method of data analysis is also provided below.The following method can calculate the ratio of live cells to dead cells in a certain region. The required samples include dead cell control group, live cell control group, and the sample group to be tested. Dead cells can be obtained by treating cells with 1% saponin or 0.1-0.5% digitalis saponin for 10 minutes.1. Prepare staining solution and follow the above steps to stain cells. Additionally, prepare 1 mL and 2 mL separately µ M Calcein AM and 4 µ M EthD-I solution, stain the control group according to the following instructions. For the following groups of cells or cell-free groups, it is necessary to maintain complete consistency in cell count, detection of working solution concentration, incubation time, and incubation temperature.2. Measurement of sample group and control group:A. The measured values of the sample group at 645 nm are denoted as Calcein AM and EthD-I=F (645) sam.B. The measured values of the sample group at 530 nm are denoted as Calcein AM and EthD-I=F (530) sam.C. The measurement value of dead cell EthD-I single staining control group at 645 nm is denoted as EthD-I=F (645) maxD. The measurement value of dead cell Calcein AM single staining control group at 645 nm is recorded as Calcein AM=F (645) minE. The measurement value of live cell EthD-I single staining control group at 530 nm is recorded as EthD-I=F (530) min.F. The measurement value of live cell Calcein AM single staining control group at 530 nm is denoted as Calcein AM=F (530) max.G. A blank control well without cells (with or without dye), the detection value at 530 nm is recorded as F (530) 0.H. A blank control well without cells (with or without dye), the detection value at 645 nm is recorded as F (645) 0.3. Calculate the ratio of dead cells to live cells based on measurement data:%Live Cells=(B-E) ÷ (F-E)%Dead Cells=(A-D) ÷ (C-D)Determine the ratio of live cells to dead cells in a certain areaBy creating fluorescence spectral standard curves at 530 nm and 645 nm, the number of dead and live cells can be determined, and the fluorescence intensity of each dye is linearly related to the number of dead or live cells in the sample.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. phenol red or serum may interfere with the detection of this kit. 3. fluorescent dyes have quenching problems. Please try to avoid light during experimental operation to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application:Dead and live cell staining (animal)... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionMetathesis: Ruthenium-Based Metathesis CatalystsRuthenium metathesis catalysts kit I consists of 9 samples of Grubbs 1st and 2nd generation catalysts. These catalysts have applications in ring-closing and ring-opening metathesis, cross-metathesis, ring-opening metathesis polymerization (DescriptionMetathesis: Ruthenium-Based Metathesis CatalystsRuthenium metathesis catalysts kit I consists of 9 samples of Grubbs 1st and 2nd generation catalysts. These catalysts have applications in ring-closing and ring-opening metathesis, cross-metathesis, ring-opening metathesis polymerization (ROMP) and enyne metathesis.Metathesis: Ruthenium-Based Metathesis Catalysts... Read More |