| Description | Inquire | Product Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 andProduct Descriptionalpha-L-fucoside fucohydrolase, alpha-L-fucosidase, alpha-(1-3,4) fucosidaseAlpha (1-3,4) Fucosidase The enzyme is very efficient and recognises α1-3,4 fucosylated glycans (e.g. Lewis X/A epitopes, including their sialylated counterparts) and hydrolyses terminal α1-3 and α1-4 fucosyl linkages in these substrates without the need to remove sialic acid moieties.For removing core fucose linked α-(1-6) to the core GlcNAc of a GlcNAc-GlcNAc disaccharide structure we recommend our Alpha-(1-6) Fucosidase.• Non-sialidase dependant hydrolysis of antennary fucose moieties• Effective on both glycopeptides and free glycans• Highly specific (α1-3,4 fucosylated glycans)• Kit includes enzyme plus reaction buffer.• Sufficient for up to 50 samplesα(1-3,4) Fucosidase is useful for:nbsp;nbsp;Fucose linkage determinationnbsp;nbsp;Deglycosylating glycoproteins with Lewis structuresContentsAlpha-(1-3,4)-Fucosidase – 200 mM citrate buffer pH 6 containing 250 mM NaCl5x Reaction Buffer – 250 mM sodium phosphate pH 6... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Product introduction：Griess reagent can be used for spectrophotometric detection of nitrite. The reagent contains two chemicals, sulfonic acid and n- (1-naphthyl) ethylenediamine. Under acidic conditions, sulfamic acid is converted into diazonium salt by nitrite, which can form a highly Product introduction：Griess reagent can be used for spectrophotometric detection of nitrite. The reagent contains two chemicals, sulfonic acid and n- (1-naphthyl) ethylenediamine. Under acidic conditions, sulfamic acid is converted into diazonium salt by nitrite, which can form a highly colored azo dye with n- (1-naphthyl) ethylenediamine. This dye can be detected at 548 nm: because no is extremely unstable, it is oxidized to form nitrite and nitrate. Griess indirectly reflects the content of no by detecting the content of nitrite.Matters needing attention：1. before using Griess reagent, return it to room temperature and check the solution for precipitation. If Griess reagent I contains sediment when taken out, it can be placed in a 37 ℃ water bath until the sediment dissolves. 2. this product is potentially harmful. Avoid prolonged or repeated exposure. Avoid entering eyes, skin or clothing. Please wear lab clothes and disposable gloves for operation.Scope of application：No detectionComponent：Instruction：1.Griess Reagent I and II were taken out to restore the room temperature.2.Standard dilution : The standard NaNO2 ( 1-100 µM ) was diluted with the solution used for the sample to be tested. The standard was diluted to 1 µM, 10 µM, 20 µM, 40 µM, 80 µM and 100 µM, and 100 µL standard was added to each well. If the sample concentration is too low, the range of the standard curve can be appropriately reduced ( 1 µM, 2 µM, 3 µM, 4 µM, 6 µM, 8 µM, 10 µM ).3.Sample detection :( 1 ) According to the total volume of 200 µL / hole, 100 µL / hole sample was added to the 96-well plate ; if the sample is the supernatant of the culture medium, it can be sampled directly, and if there is sediment, the supernatant should be taken after centrifugation. If the sample is a cell or tissue, it can be quickly lysed by freeze-thaw, and then centrifuged to obtain the supernatant. The volume of less than 100 µL can be diluted with diH2O or 0.9 % NaCl ( corresponding standards also need to be diluted with diH2O or 0.9 % NaCl ).( 2 ) According to 50 µL / hole, Griess Reagent I was added to each hole.( 3 ) According to 50 µL / hole, Griess Reagent II was added to each hole.( 4 ) The absorbance was measured at 540 nm. If there is no 540 nm filter, 520-560 nm filter can also be. If there is no microplate reader or a suitable filter, the concentration of nitric oxide in the sample can also be determined by visual colorimetry. A more precise concentration gradient is required for the standard when visual colorimetric... Read More |