| Description | Inquire | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | Glycogen and starch generate glucose-1-phosphate (1PG/G1P) during the process of phosphohydrolysis. This reagent kit provides a simple, sensitive, and rapid determination method: Glucose-1-phosphate (1PG/G1P) is reduced from NADP+to NADPH by the sequential action of phosphoglucose mutase and Glycogen and starch generate glucose-1-phosphate (1PG/G1P) during the process of phosphohydrolysis. This reagent kit provides a simple, sensitive, and rapid determination method: Glucose-1-phosphate (1PG/G1P) is reduced from NADP+to NADPH by the sequential action of phosphoglucose mutase and phosphoglucose dehydrogenase. The content of glucose-1-phosphate (1PG/G1P) in the sample can be calculated by detecting the increase in NADPH at 340nm.Composition and preparation of reagent kit: Reagent name Specifications Save requirements Remarks Extraction solution Liquid 100mL x 1 bottle 4 ℃ storage / Reagent 1 Powder mg x 1 tube 4 ℃ storage Shake or centrifuge the reagent a few times before use to make it fall to the bottom, then dissolve it in 1.2mL of distilled water for later use. Reagent 2 Powder mg x 1 tube Store at -20 ℃ Shake or centrifuge the reagent a few times before use to make it fall to the bottom, then dissolve it in 1.2mL of distilled water for later use. Reagent 3 Liquid 16mL x 1 bottle 4 ℃ storage / Reagent 4 Powder mg x 1 tube Store at -20 ℃ Shake or centrifuge the reagent a few times before use to make it fall to the bottom, then add 1 Dissolve 1mL of distilled water for later use. TRC 1 powder 4 ℃ storage Only used to identify whether the reagents in the kit are normal (not involved in result calculation). Usage: Use a pre standard tube (GIP) to shake the powder a few times until it falls to the bottom, then add 0.5mL of distilled water and mix well to dissolveDilute GIP with a concentration of 4mg/mL and then dilute it four times to 1mg/mL for later use: follow the instructions in the sample addition table for the measuring tube operationRequired instruments and supplies:ELISA reader, 96 well plate, desktop centrifuge, adjustable pipette, mortar, ice and distilled water.Determination of glucose-1-phosphate (1PG/G1P) content:1. Sample preparation① Organizational sample:Suggest weighing around 0 1g of tissue, add 1mL of extraction solution, and homogenize in an ice bath. Centrifuge at 12000rpm, 4 ℃ for 10 minutes, take the supernatant, and place it on ice for testing.[Note]: If the sample size is increased, it can be extracted in a ratio of tissue mass (g) to extraction solution volume (mL) of 1:5-10.② Bacterial/cellular samples:Collect bacteria or cells into a centrifuge tube first, centrifuge and discard the supernatant; Take about 5 million bacteria or cells and add them to 1mLExtract solution, sonicate bacteria or cells (ice bath, power 200W, sonication for 3s, interval 10s, repeated 30 times); Centrifuge at 12000rpm at 4 ℃ for 10 minutes, take the supernatant, and place it on ice for testing.[Note]: If the sample size is increased, extraction can be carried out in a ratio of 500-1000:1 of bacteria/cell quantity (104) to extraction solution (mL).③ Liquid sample: direct detection.2. Machine testing:① Preheat the enzyme-linked immunosorbent assay (ELISA) reader for at least 30 minutes and adjust the wavelength to 340nm.② Thaw the reagent to room temperature (25 ℃);③ Add reagents to the 96 well plate in the following order according to the table:② Thaw the reagent to room temperature (25 ℃);③ Add reagents to the 96 well plate in the following order according to the table: Reagent name (µL） Measurement tube Blank tube (only done once) Reagent 1 10 10 Reagent 2 10 10 Reagent 3 150 170 Sample 20 / Mix well, incubate at room temperature (25 ℃) for 20 minutes, and then read A1 at 340nm (if the A value continues to increase, the incubation time needs to be extended until the absorbance value remains unchanged within 2 minutes). Reagent 4 10 10 Mix well, incubate at room temperature (25 ℃) for 20 minutes, and then read A2 at 340nm (if the A value continues to increase, the incubation time needs to be extended until the absorbance value remains unchanged within 2 minutes). Δ A=(A2-A1) measurement - (A2-A1) blank.[Note] 1 If the difference in Δ A is hovering around zero, the sample size V1 can be increased (such as increasing to 50 µ L, the three phases of the reagent should be reduced while keeping the total volume unchanged), or the sample sampling mass W can be increased. The changed V1 and W need to be substituted into the formula for recalculation.If the A2 value exceeds 1.2, the amount of sample added V1 can be reduced (such as to 10 µ L, the three-phase reagent should be increased while keeping the total volume unchanged), or the sample can be diluted with distilled water (keeping the sample addition system unchanged), and the changed V1 and D need to be substituted into the formula for recalculation.Result calculation:1. Calculated by sample weight:1PG/G1P content (µ g/g fresh weight)=[(Δ A ÷ (ε× d) × V2 × 106 × MR] ÷ (W × V1 ÷ V) × D=836 × Δ A ÷ W × D2. Calculated by the number of cells:1PG/G1P content (µ g/104 cell)=[(Δ A ÷ (ε× d) × V2 × 106 × MR] ÷ (500 × V1 ÷ V) × D=1.7 × Δ A × D. 3. Calculated by liquid volume:1PG/G1P content (µ g/mL)=[(Δ A ÷ (ε× d) × V2 × 106 × Mr] ÷ V1=836 × Δ A ε---NADPH Molar extinction coefficient，6.22×103 L/mol/cm； d---96 Orifice plate optical diameter，0.5cm； V---Add volume of extraction solution，1 mL； V1---Add sample volume，0.02mL V2---Total reaction volume；0.2mL=2×10-4L； W---Sample quality，g； Mr---Glucose-1-phosphate（1PG/G1P）Molecular weight；260； 500---Number of cells, in millions； D---Dilution ratio，Undiluted is 1。 /... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product contentcomponent50T200TBuffer LP125mL100mLBuffer LP210mL40mLBuffer LP3 (concentrate)21ml84mlBuffer GW2 (concentrate)15mL75mlBuffer GE15mL60mLRNase A（10 mg/ml）300µl1.25mLSpin Columns DM with Collection Tubes50200ProductsThis kit uses centrifugal adsorption columns with highProduct contentcomponent50T200TBuffer LP125mL100mLBuffer LP210mL40mLBuffer LP3 (concentrate)21ml84mlBuffer GW2 (concentrate)15mL75mlBuffer GE15mL60mLRNase A（10 mg/ml）300µl1.25mLSpin Columns DM with Collection Tubes50200ProductsThis kit uses centrifugal adsorption columns with high efficiency and specific binding of nucleic acids and a unique buffer system, which is suitable for extracting genomic DNA from a wide variety of different fresh or frozen plant tissues with maximum removal of impurities from the plant tissues. The kit eliminates the need for phenol/chloroform extraction and is safe to handle. The extracted genomic DNA fragments are large, high purity, stable and reliable quality, suitable for PCR, fluorescence quantitative PCR, molecular labeling, library construction and other experiments.Self-contained reagent: anhydrous ethanolPre-experiment Preparation and Important Notes1. Repeated freezing and thawing of the sample should be avoided, as this may result in smaller fragments of extracted DNA and a decrease in the amount extracted.2. Anhydrous ethanol should be added to Buffer LP3 and Buffer GW2 according to the instructions on the label of the reagent bottle before first use. Check Buffer LP1 and Buffer LP2 for crystallization or precipitation before use. If crystallization or precipitation occurs, re-dissolve Buffer LP1 and Buffer LP2 in a 56°C water bath. Procedure1. Take about 100mg of fresh plant tissue or about 20mg of dry weight tissue and add liquid nitrogen to grind it fully.2. Collect the ground powder into a centrifuge tube (self-provided), add 400 µl Buffer LP1 and 6 µl RNase A (10 mg/ml), vortex and oscillate for 1 minute, and leave it at room temperature for 10 minutes to allow for full cleavage.Note: 1) Use vortex shaking or pipette blowing to fully lyses the tissue, incomplete tissue lysis will affect the final DNA yield. 2) Do not mix Buffer LP1 with RNase A prior to use.3. Add 130 µl Buffer LP2, mix well and vortex for 1 minute.4. Centrifuge at 12,000 rpm (~13,400 x g) for 5 minutes and transfer the supernatant to a new centrifuge tube (supplied).5. Add 1.5 times the volume of Buffer LP3 (check that anhydrous ethanol has been added before use) and mix thoroughly (e.g., 500 µl filtrate to 750 µl Buffer LP3).Note: Buffer LP3 should be mixed immediately after addition; precipitation may occur but will not affect subsequent experiments.6. Add all of the solution and precipitate obtained in the previous step to the adsorption columns (Spin Columns DM) that have been loaded into the collection tubes, if the solution cannot be added all at once, it can be transferred in several times. centrifuge the columns at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tubes, and put the columns back into the collection tubes.7. Add 500 µl of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: If the adsorbent membrane appears green, add 500 µl of anhydrous ethanol to the adsorbent column, centrifuge the column at 12,000 rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorbent column back into the collection tube.8. Repeat step 7.9. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column, which can interfere with subsequent enzymatic reactions (digestion, PCR, etc.).10. Place the adsorption column in a new centrifuge tube (supplied), add 50-100 µl of Buffer GE or sterilized water dropwise to the middle of the adsorbent membrane, leave it at room temperature for 2-5 minutes, and centrifuge it at 12,000 rpm for 1 minute to collect the DNA solution. -The DNA solution was collected by centrifugation at 12,000 rpm for 1 min.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH value of the eluent has a great influence on the elution efficiency, if you use water as the eluent, you should ensure that the pH value is 7.0-8.5 (you can use NaOH to adjust the pH value of the water to this range), and when the pH value is lower than 7.0, the elution efficiency is not high.2) Incubation at room temperature for 5 minutes prior to centrifugation increases yield.(3) If the final concentration of DNA is to be increased, the DNA eluate obtained in step 10 can be re-added to the adsorbent membrane and repeat step 10; if the elution volume is less than 100µl, the final concentration of DNA can be increased, but it may reduce the total DNA yield. If the amount of DNA obtained is less than 1µg, 50µl Buffer GE is recommended for elution.4) Because DNA stored in water is subject to acidic hydrolysis, for long-term storage, elution with Buffer GE and storage at -20°C are recommended... Read More |