| Description | Inquire | Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '-Cell proliferation detection is a basic experimental method to evaluate the health of cells, genotoxicity and the effect of antitumor drugs. The most accurate method to detect cell proliferation is the BrdU method. Edu detection kit is a revolutionary breakthrough of BrdU method. Edu (5-ethynyl-2 '- deoxyuridine) is a pyrimidine analog that integrates into the DNA duplex during DNA synthesis. Edu detection is based on the "click" reaction. A copper catalyzed azide reacts covalently with alkynes to form covalent bonds. In this kit, edu contains alkynes, Aladdin ® 488 / 555/594/647a azide dyes contain azide compounds. The edu labeling proliferation of click method is rapid and effective, and easy to use. BrdU method requires DNA denaturation (such as acid denaturation, thermal denaturation or digestion with DNase) to expose BrdU, so as to facilitate BrdU antibody binding; The edu method only needs paraformaldehyde fixation and Triton X-100 penetration to make the detection reagent enter the cells, and only a small amount of azide dye is needed to label the integrated edu very effectively. This kit contains all components required for edu method detection, and can be used for proliferation detection of cultured cells in vitro. Component:Product parameters: 590/617 nm Instruction:Experimental materials (self provided). 10 mM PBS, pH 7.2-7.6. 4% paraformaldehyde fixing solution (in PBS)Propensive reagent (0.5% Triton X -100 in PBS). 2 mg/mL glycine solution (in ddH2O). 3% BSA in PBS, pH 7.2-7.6. 1% BSA in PBS, pH 7.2-7.6. ddH2O. 96/24/12/6 well culture plate or dishFluorescence microscopy detection method1. Cell cultureTake logarithmic growth stage cells and inoculate them into a 96 well plate with 4 × 103-1 × 105 cells per well (the number and density of cells can be adjusted according to cell size, growth rate, and specific requirements of experimental treatment), and culture until normal growth stage.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU marking(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to incubation time,Short term incubation (<2 hours) should use high concentrations, such as 10-50 µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash the cells twice with a 3% BSA washing solution after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, remove the culture medium. Wash cells twice with 1X PBS for 5 minutes each time to remove EdU residues that have not been incorporated into DNA. Cells with weak adhesion can reduce cleaning intensity. Join 50 µ After incubating at room temperature for 20 minutes with 4% paraformaldehyde fixative, remove the fixative.(2) Add 50 to each hole µ L 2 mg/mL glycine solution, incubate at room temperature for 5 minutes, and neutralize the remaining fixed solution.(3) At a rate of 100 per hole µ Wash cells twice with 3% BSA.(4) Remove the washing solution and add 100 µ L 0.5% Triton X -100, incubate at room temperature for 10 minutes.5. EdU detectionNote: Each sample in this reference step uses 100 µ The working fluid of L can be adjusted by users according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer (component C): Dilute component C 10 times with ddH2O.(2) Configure 5 x Click iT EdU buffer additives (component E): add 300 µ Mix L of ddH2O into a 30 mg E component tube (final concentration of 100 mg/mL) until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio, and prepared into a 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 1.Table 1 Click it working fluid Reaction components Taking the sample size of 10 holes as an example 1 x Click it EdU reaction buffer 855 µL CuSO4 (component D) 40 µL YF® 488/555/594/647A Azide(Component B) 5 µL 1 x Click it EdU buffer additive 100 µL Total volume 1 mL (5) Remove penetration enhancer, 100 per well µ Wash twice with 3% BSA washing solution of L.(6) Add 100 to each hole µ L Click iT working solution, evenly covering cells.(7) Incubate at room temperature in dark for 30 minutes.(8) Remove Click-iT working fluid and add 100 µ After washing cells twice with 3% BSA, remove the washing solution and add 100 µ L PBS keeps cells moist. If there are no other special requirements, photography analysis can be carried out.6. DNA re staining (optional)(1) Using 100 µ Wash the cells once with PBS and remove the washing solution.(2) Dilute Hoechst 33342 (component F) 2000 times with PBS.(3) Add 100 to each hole µ Incubate L 1 x Hoechst 33342 solution at room temperature in dark for 15-30 minutes.(4) Remove Hoechst 33342 solution and use 100 µ Wash cells twice with PBS.7. Imaging and analysisIt is recommended to take fluorescence microscopy photos immediately after staining is completed for observation; If conditions permit, please store in a dark and moist environment at 4 ° C for 3 days before taking photos. Flow cytometry detection method1. Cell cultureInoculate 1 × 105~3 × 106 cells per well into a 6-well plate.2. Drug treatmentPerform various drug treatments according to experimental needs.3. EdU labeled cells(1) Dilute EdU solution (component A) in a certain proportion with complete cell culture medium to an appropriate concentration, then add it to the cells and mix well; Set up a negative control group without EdU treatment.Note: The labeling concentration of EdU needs to be adjusted according to cell type, and it is recommended to explore with an initial concentration of 10 µ M. In the pre experiment, it is recommended to set an EdU concentration gradient, which can be referred to in Tables 2 and 3.(2) Incubate in a cell culture incubator for 2 hours. The time of EdU incubation of cells can be directly used as an indicator for measuring cell DNA synthesis, and the choice of time point and incubation time depend on the cell growth rate. Pulse labeled cells incubated with brief EdU can be used to study cell cycle dynamics.Note: The optimal incubation time is related to the cell cycle. Most tumor cell lines can use a 2-hour incubation time, as shown in Appendix 2. The concentration of EdU is related to the incubation time, and high concentrations, such as 10-50, should be used for short-term incubation (<2 hours) µ M; Long term incubation (>24 hours) should use low concentrations, such as 1-10 µ M; You can also refer to Appendix 3.4. Cell fixation and permeation promotionNote: For experiments that require cell surface antigen labeling, it can be considered to wash cells twice with 1% BSA after completing EdU incubation, before cell fixation and permeation promotion.(1) After incubation, collect cells, add 1 mL of PBS to each tube to clean the cells, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant to remove EdU residue that has not been added to DNA.(2) Add 1 mL of 4% paraformaldehyde fixative to each tube to resuspend cells.(3) Incubate at room temperature for 20 minutes, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(4) Add 1 mL of 2 mg/mL glycine to each tube and incubate for 5 minutes. Neutralize the remaining fixed solution, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant. Add 1 mL of PBS to each tube for cleaning once, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.(5) Add 1mL of 0.5% Triton X-100 osmotic enhancer to each tube and resuspend cells. Incubate at room temperature for 10 minutes.5. EdU detectionNote: For 6-well plate samples, reference can be made to 1 mL of working solution per well. Users can adjust the dosage according to their own sample situation.(1) Prepare 1 x Click iT EdU reaction buffer: Dilute component C 10 times with ddH2O.(2) Prepare 5 x Click iT EdU buffer additives (component E): Add 300 µ L ddH2O to 30 mg of component E in a test tube (final concentration 100 mg/mL), mix well until completely dissolved. After use, the remaining storage solution is stored at -20 ℃ and can be stored for one year. Once the solution turns brown, it indicates that the active ingredients have degraded and cannot be reused.Note: Different specifications of component E are dissolved in ddH2O according to this ratio to form 5 x storage solution for future use.(3) Prepare 1 x Click iT EdU buffer additive: Dilute 5 x Click iT EdU buffer additive storage solution with ddH2O to 1 x, and the solution should be prepared and used immediately.(4) Prepare Click it working solution according to Table 2.Table 2 Click it working fluid Reaction components Volume of liquid required for a single reaction 1×Click-iT EdU reaction buffer 875 µL CuSO4 (component D) 20 µL YF® 488/555/594/647A Azide(Component B) 5 µL 1×Click-iT EdU buffer additive 100 µL Total volume 1 mL (5) Soak at 1000 rpm for 5 minutes, discard the supernatant, remove the enhancer, add 1mL of 1% BSA washing solution to each tube and wash twice. Soak at 1000 rpm for 5 minutes, discard the supernatant.(6) Add 1 mL of Click iT working solution to each tube and mix well.(7) Incubate at room temperature in dark for 30 minutes.(8) Soak at 1000 rpm for 5 minutes, discard the staining reaction solution, add 1% BSA to each tube to wash the cells twice, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and resuspend the cells again with 1 mL of 1% BSA (the volume of resuspend cells can be adjusted according to the number of cells), and detect with a flow cytometer.Note: If other biomarker tests are required, please refer to step 4.6. Intracellular antigen labeling (optional steps)(1) Add antibody working solution and mix well.(2) Under dark conditions, incubate antibodies at appropriate temperature and time.7. Flow detection and analysis:(1) It is recommended to conduct flow cytometry testing immediately after dyeing is completed; If conditions are limited, please store in a dark place at 4 ℃ for testing, but it should not exceed 3 days.(2) It is recommended to test the number of cells up to one million levels as much as possible. If the number of cells is small, the number of cells tested can be adjusted to 100000 levels starting from the experiment. For cases where the cell yield is too low (just to the level of ten thousand), it may not be conducive to making a flow chart. Therefore, the cleaning frequency in step 5 (8) can be appropriately reduced.Matters needing attention:1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. fluorescent dyes have quenching problems. Please try to avoid light during experimental operation to slow down fluorescence quenching. 3. click it edu buffer additive solution should be prepared and used immediately to ensure the best results. 4. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application:Cell proliferation detection (cell imaging flow universal)... Read More | This reagent kit is suitable for simultaneously isolating and purifying genomic DNA, total RNA, and total protein from the same cell or tissue sample. This product does not require dividing the sample into three parts to extract DNA, RNA, and protein separately, nor does it require dividing the This reagent kit is suitable for simultaneously isolating and purifying genomic DNA, total RNA, and total protein from the same cell or tissue sample. This product does not require dividing the sample into three parts to extract DNA, RNA, and protein separately, nor does it require dividing the purified total nucleic acid into two parts before purifying DNA and RNA separately. Therefore, it can maximize the recovery of DNA, RNA, and protein, and can be used for the purification of nucleic acid and protein in small and rare samples. The purified DNA, RNA, and protein can be eluted separately and directly applied to various downstream molecular biology operations. This reagent kit does not contain toxic substances such as phenol and chloroform, and does not require ethanol precipitation. The operation is simple and fast. The extracted genomic DNA can be used for PCR, Real time PCR, SouthBlot, Dot Blot, comparative genomic hybridization (CGH), gene analysis, and SNP analysis; Total RNA can be applied in experiments such as RT-PCR, cDNA synthesis, Northern Blot, Dot Blot, and gene chips; Total protein can be applied in electrophoresis and Western Blot, among others. A665492 Component 50 T Storage A665492A Buffer RL 35 mL RT A665492B Buffer RW1 40 mL RT A665492C Buffer RW2 (concentrate) 11 mL RT A665492D RNase-Free Water 10 mL RT A665492E Buffer GW1 (concentrate) 13 mL RT A665492F Buffer GW2 (concentrate) 15 mL RT A665492G Buffer GE 15 mL RT A665492H Buffer PZ 60 mL RT A665492I Buffer PLS 15 mL RT A665492J Spin Columns DM with Collection Tubes 50 sets RT A665492K Spin Columns RM with Collection Tubes 50 sets RT A665492L Collection Tubes 100 EA RT A665492M RNase-Free Centrifuge Tubes (1.5 mL) 100 EA RTSelf prepared reagents:β- Mercaptoethanol (for newly opened or RNA extraction), 70% ethanol (prepared with water without RNase), and anhydrous ethanol.Preparation and important precautions before the experiment:To prevent RNase pollution, attention should be paid to the following aspects:1) Use plastic products and gun heads without RNase to avoid cross contamination.2) Glassware should be dry baked at a high temperature of 180 ℃ for 4 hours before use, while plastic containers can be soaked in 0.5 M NaOH for 10 minutes, thoroughly rinsed with water, and then sterilized under high pressure.3) The solution should be prepared using water without RNase.4) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The sample should avoid repeated freeze-thaw cycles, otherwise it will affect the quality of DNA, RNA, and protein extraction. The sample can be stored in Buffer RL at -70 ℃ for one month.3. Please add Buffer RL before use β- Mercaptoethanol, 1 ml Buffer RL with 10 µ L β- Mercaptoethanol. join β- The buffer RL room temperature of mercaptoethanol can be stored for one month.Before the first use, anhydrous ethanol should be added to Buffer RW2, Buffer GW1, and Buffer GW2 according to the instructions on the reagent bottle label.5. Before use, please check if there is any crystallization or precipitation in the Buffer RL. If there is any crystallization or precipitation, please dissolve it again in a 56 ℃ water bath.6. All centrifugation steps are performed using a desktop centrifuge at room temperature. Operation steps:1. Material processing1a The cells cultured on the wall should be first processed into cell suspension (maximum extraction amount of 107 cells), collected cells, discarded the culture medium, and added 600 cells µ L Buffer RL (check if it has been added before use) β- Mercaptoethanol), repeatedly blow and beat to fully decompose.Attention: It is necessary to discard the culture medium completely, otherwise it will affect the lysis and subsequent nucleic acid purification steps.1b Take no more than 30 mg of animal tissue, grind it into fine powder with liquid nitrogen, and add 600 µ Buffer RL (check if it has been added before use) β- Mercaptoethanol, or directly add 600 µ L Buffer RL (check if it has been added before use) β- Mercaptoethanol, homogenization treatment.Attention: The homogenate should be sufficient, otherwise it will affect RNA production.2. Centrifuge the solution obtained in the previous step at 12000 rpm (~13400 × g) for 3-5 minutes. Carefully add the supernatant to the spin columns DM that have been loaded into the collection tube. Centrifuge at 12000 rpm for 30-60 seconds and collect the filtrate. Place the adsorption column DM in a new 2 ml collection tube at room temperature or 4 ℃ for DNA extraction. Attention: Ensure that there is no liquid residue on the adsorption column, and if necessary, repeat centrifugation until all liquids pass through the membrane of the adsorption column. Total RNA extraction3. Add 1 volume of 70% ethanol (prepared without RNase water) to the filtrate obtained in step 2, and mix well.4. Add all the solution obtained in the previous step to the spin columns RM that have been loaded into the collection tube. If the solution cannot be added completely at once, it can be transferred in stages. Centrifuge at 12000 rpm for 20 seconds and retain the liquid in the collection tube for protein extraction.5. Place the adsorption column RM into a new 2ml collection tube and add 700 to the adsorption column RM µ L Buffer RW1, centrifuge at 12000 rpm for 20 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM into the recovery manifold.6. Add 500 to the adsorption column RM µ Buffer RW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 20 seconds, discard the waste liquid in the collection tube, and place the adsorption column RM back into the 2 ml collection tube.7. Repeat step 6.Centrifuge at 8.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes to thoroughly air dry. Attention: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).9. Place the adsorption column RM in a new 1.5 ml centrifuge tube without RNase, and add 30-50 to the middle of the adsorption column RM µ Place RNase Free Water at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ l. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 9 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 9.Genomic DNA extraction10. Add 500 to the adsorption column DM µ Buffer GW1 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 20 seconds, discard the waste liquid in the collection tube, and place the adsorption column DM into the recovery tube.11. Add 500 to the adsorption column DM µ Buffer GW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 2 minutes, discard the waste liquid in the collection tube, and place the adsorption column DM into the recovery tube. Attention: To further improve DNA purity, repeat step 11.Centrifuge at 12.12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column DM at room temperature for a few minutes to thoroughly dry the ethanol in the column. Attention: The purpose of this step is to remove residual ethanol from the adsorption column, which can affect subsequent enzymatic reactions (such as enzyme digestion, PCR, etc.).13. Place the adsorption column DM in a new centrifuge tube and add 100 to the middle of the adsorption column DM by suspending it in the air µ L Buffer GE, leave at room temperature for 2-5 minutes, centrifuge at 12000 rpm for 2 minutes, collect DNA solution, and store DNA at -20 ℃.Attention:1) The volume of Buffer GE should not be less than 100 µ l. Small volume affects the recovery rate.2) If we want to increase DNA production, we will µ Add a new Buffer GE to the adsorption column and repeat step 13; If you want to increase the DNA concentration, you can add the DNA eluent obtained in step 13 back onto the adsorption column and repeat step 13.Protein extraction14. Add 1 volume of Buffer PZ to the RNA extraction effluent (i.e. the solution obtained in step 4), mix well, and let it stand at room temperature for 10-30 minutes.Centrifuge at 15.12000 rpm for 10 minutes and discard the supernatant.16. Add 500 µ Centrifuge at 12000 rpm for 1 minute with 70% ethanol, and try to absorb the supernatant as much as possible.17. Place the centrifuge tube at room temperature for a few minutes to dry the precipitate.Attention: The purpose of this step is to remove residual ethanol. Excessive drying can make protein precipitation difficult to dissolve, and incomplete drying of residual ethanol can affect protein loading.18. Add 100 µ L Buffer PLS to obtain protein solution.Attention:1) The protein samples obtained by dissolving with Buffer PLS are suitable for SDS-PAGE and Western Blot detection, but not for Bradford method for protein quantification. If Bradford method is needed for protein quantification, 5% SDS can be used to dissolve the protein, or suitable protein dissolution buffer can be selected based on downstream experiments.2) The amount of dissolved protein buffer added is determined based on the initial sample size and specific downstream test requirements.3) The dissolved protein can be stored at -20 ℃ for several months and at 2-8 ℃ for several days.If protein samples require SDS-PAGE electrophoresis, the following operations can be performed:19. Add protein loading buffer to the protein sample, denature at 95 ℃ for 5-10 minutes, and cool the sample to room temperature. Centrifuge at 20.12000 rpm for 1 minute, extract the supernatant for downstream SDS-PAGE or Western blot tests... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | The commonly used method of eukarYOtic gene expression regulation research is the detection of reporter genes, and bioluminescence is the most commonly used and effective means of reporter gene detection. Luciferase can catalyze the conversion of the substrate luciferin and emit photons. This The commonly used method of eukarYOtic gene expression regulation research is the detection of reporter genes, and bioluminescence is the most commonly used and effective means of reporter gene detection. Luciferase can catalyze the conversion of the substrate luciferin and emit photons. This product provides a rapid, sensitive and stable detection method for the expression of Renilla luciferase reporter gene in mammalian cells. Product characteristic:1.Rapid : Cell lysis was completed within 10-15 min ;2.Convenience : The reagent is easy to prepare, and the sample detection steps are simple;Instruction:1. Cell lysis ( 1 ) Remove the culture medium and gently wash with PBS ( adherent cells can be directly performed this operation, suspension cells should be centrifuged to collect cells ). Add 1 × Lysis Buffer ( diluted component A with sterile water at 4 : 1 ) according to the following scheme, and then place the culture plate on a micro-oscillator at room temperature for 15 min to fully lyse the cells. Note : The pyrolysis products can be stored at room temperature for 6 h, and can be stored at − 70 °C for a long time ( the pyrolysis products cannot be repeatedly frozen and thawed ). ( 2 ) The pyrolysis products after full pyrolysis were centrifuged at 10000-15000 rpm for 3-5 min. After centrifugation, the supernatant was moved into a new EP tube for subsequent detection. 2. Preparation of working fluid ( 1 ) Restore all components to room temperature. ( 2 ) Dilute component C into renilla luciferase working solution with component B, and the dilution method is to add 1 µL C component to 49 µL B component. 3.chemiluminescence value detection ( 1 ) According to the operation instructions of the instrument, the instrument with chemiluminescence detection function was opened, such as multifunctional microplate reader. The parameters were set, the determination time was 10 s, and the determination interval was 2 s. ( 2 ) The cell lysis products were added to the measuring tube according to the volume of 20 ~ 100 µL ( keep the same amount of samples each time ). 1 × Lysis Buffer was blank control. ( 3 ) 100 µL renilla luciferase working solution was added to determine the RLU ( Relative light unit ) value ( Shaking mixing function is recommended for microplate reader ). Note : The renilla luciferase working solution cannot be stored for a long time. It is now ready for use and is used once. Component:RenillaLuciferase Lysis Buffer;RenillaLuciferase Assay Buffer;CoelenterazineMatters needing attention:Scope of application: Matters needing attention:1.Please instantaneously centrifuge the product to the bottom of the tube before use, and then carry out subsequent experiments ; 2.Due to the influence of temperature on the enzyme reaction, the sample and reagent should be measured after reaching room temperature. 3.The strongest wavelength of bioluminescence catalyzed by renilla luciferase is 480 nm, in order to prevent interference between holes, it is recommended to use white opaque orifice plate ;4. B component is recommended to carry out small batch packing according to the experimental requirements ; 5.It is recommended to use it now to avoid repeated freezing and thawing ; 6.For your safety and health, please wear experimental clothes and wear disposable gloves. Scope of application:Study on gene expression regulation and promoter... Read More |