| Description | Inquire | Calcein AM /PI Double Staining Kitis utilized for simultaneous fluorescence staining of viable and dead cells. This kit contains Calcein-AM and Propidium Iodide (PI) solutions, which stains viable and dead cells, respectively(Fig. 1). Calcein-AM, an acetoxymethyl ester of calcein, is highly Calcein AM /PI Double Staining Kitis utilized for simultaneous fluorescence staining of viable and dead cells. This kit contains Calcein-AM and Propidium Iodide (PI) solutions, which stains viable and dead cells, respectively(Fig. 1). Calcein-AM, an acetoxymethyl ester of calcein, is highly lipophilic and cell membrane permeable. Though Calcein-AM itself is not a fluorescent molecule, the calcein generated from Calcein-AM by esterase in a viable cell emits a strong green fluorescence (excitationat 490 nm, emission at515 nm). Therefore, Calcein-AM only stains viable cells. On the other hand, PI, a nuclei staining dye, cannot pass through a viable cell membrane. It reaches the nucleus by passing through disordered areas of dead cell membrane, and intercalates with the DNA double helix of the cell to emit red fluorescence (excitation: 535 nm,emmision: 617 nm). Since both calcein and PI-DNA can be excited with 490 nm, simultaneous monitoring of viable and dead cells is possible with a fluorescence microscope. With 545 nm excitation, only dead cells can be observed (Fig. 1). Since optimal staining conditions differ from cell line to cell line, we recommend that a suitable concentration of PI and Calcein-AM be individually determined. Please note that PI is suspected to be highly carcinogenic;careful handling is required.Required Equipment and Materials:Microscope with 490 nm excitation filter and 530 nm emission filter；CO2incubator；10 µl and 200 µl adjustable pipettes, PBSSolution A (Calcein-AM)；Solution B (PI) Storage Condition: -20oC ；Shipping Condition: blue ice.Application:Assay Procedure1)Add 2.5 µl Solution A and 12.5 µl Solution B to 5 ml PBS to prepare assay solution.*2)Wash the cell with PBS several times to remove residual esterase activity.3)Add 100uLof assay solution to200uL105~106CELLSsolution and incubate the mixture at 37oC for 15 min.4)Detect fluorescence using a fluorescence mircoscope with 490 nm excitationfor simultaneous monitoring of viable and dead cells.With 545 nm excitation, only dead cells can be observed.*The following steps may be necessary tooptimizethe suitable concentration of each reagent:1)Prepare dead cells by 10 min incubation in 0.1% saponin or 0.1-0.5% digitonin or by 30 min incubation in 70% ethanol.2)Stain dead cells with 0.1-10 µM PI solution to find a PI concentration that stains the nucleus only, not the cytosol.3)Stain dead cells with 0.1-10 µM Calcein-AM solution to find a Calcein-AM concentration that does not stain the cytosol. Then stainviable cells with that Calcein-AM solution to check whether the viable cell can be stained... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Component Description T665563Component50 TStorageApplicationT665563AVNTR3820 1 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563BVNTR41201 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563CVNTR32321 mL-20℃. Avoid freeze/thaw Component Description T665563Component50 TStorageApplicationT665563AVNTR3820 1 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563BVNTR41201 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563CVNTR32321 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563DMarkerⅠ300 µL-20℃. Avoid freeze/thaw cycle.DNA Molecular Weight Standard IT665563EMarkerⅡ250 µL-20℃. Avoid freeze/thaw cycle.DNA Molecular Weight Standard IIProduct IntroductionThis kit is a genotyping product for human Mycobacterium tuberculosis based on the latest research progress in molecular epidemiology1) and optimized by process. It utilizes variable-number tandem repeats (VNTR) polymorphisms in the Mycobacterium tuberculosis genome for genotyping to differentiate clinical strains, and is a powerful tool for studying the molecular epidemiology of Mycobacterium tuberculosis and monitoring the status of tuberculosis transmission. Compared with other existing Mycobacterium tuberculosis VNTR typing systems based on the VNTR principle, this typing system has a stronger ability to discriminate strains prevalent in China1,2,3), and is therefore particularly suitable for the needs of Chinese users.By carefully optimizing the primer sequences of each PCR reaction and the composition of the premixed reaction solution, this product has a strong anti-interference power. Compared with the user's own reagents, this product significantly improves the signal intensity of specific bands and reduces the appearance of non-specific bands when using crude templates (boiling bacterial solution), which makes the experimental operation easier and quicker, and at the same time, improves the success rate of the test. The premixed reaction solution is chemically stable and can effectively withstand repeated freezing and thawing (10 times) and a longer period of time (one week) at room temperature, which is better adapted to the user's need for flexibility in the detection work.This kit is a companion product to the TB Genotyping Kit VNTR-9. For samples identified as clustered or identical strains by the VNTR-9 kit, this product can be used for finer further typing identification if necessary. The three high-resolution detection sites VNTR3820, VNTR4120 and VNTR3232 in this product can be used in combination with the nine detection sites in the VNTR-9 to increase the resolution index (Hunter-Gaston index (HGI) to 0.9931).References1) Luo T et al. Development of a hierarchical variable-number tandem repeat typing scheme for Mycobacterium tuberculosis in China. PLoS One. 2014 Feb 25. 9(2)2)Sun G et al. Discriminatory potential of a novel set of Variable Number of Tandem Repeats for genotyping Mycobacterium marinum. Vet Microbiol. 2011 Aug Vet Microbiol. 2011 Aug 26;152(1-2)3) Zhang L et al. Highly polymorphic variable-number tandem repeats loci for differentiating Beijing genotype strains of Mycobacterium tuberculosis in Shanghai, China. FEMS Microbiol Lett. 2008 May;282(1):22-31.matters needing attention1.This product is a companion to the TB genotyping kit VNTR-9. The strains to be tested should be tested by VNTR-9 typing test first, and then use this product for testing. And the results of this product should be integrated and analyzed with the results of VNTR-9.2.To avoid contamination, it is recommended that the preparation of the organisms be done within a different location than the preparation of the PCR Mix and that different pipettes be used.3.Care should be taken at all stages of sample DNA collection, extraction and amplification to ensure proper labeling and to prevent cross-contamination between different samples.4.Commonly used reagents and consumables need to be autoclaved before experimentation.5.Each tube of PCR Mix contains different primers and cannot be mixed. It can be dispensed into different amounts at once according to the experimental needs to avoid repeated freezing and thawing.6.To avoid splashing the reaction solution when opening the reaction tube, centrifuge briefly before opening the cap and collect the liquid at the bottom of the tube. In case of accidental splashing on gloves or table, change gloves immediately and wipe the table with 75% alcohol or dilute acid.7.Be careful not to cross-contaminate the PCR Mix when aspirating, and it is recommended that the pipette tip be wiped with 75% alcohol 2 times before taking Mix each time.8.Pre-experiment preparation: 1×TE buffer (PH=8.0), 0.5×TBE buffer, agarose, ethidium bromide (EB), normal PCR instrument, DNA electrophoresis equipment and gel imager, 0.2 ml PCR reaction tubes, octuplex or 96-well PCR tubes, pipettes of different sizes: 0.5-10 µl and 20-200 µl.Operation steps1. DNA template preparation:1.1. scrape a small amount (1-2 inoculation loops) of sample from solid medium, resuspend in 100ul TE and inactivate at 80°C for 30 minutes.1.2. The inactivated strain was taken out of the P3 laboratory as follows:Boil at 100°C for 10 minutes (be careful to avoid bursting the cap of the EP tube during boiling to avoid letting water into the tube), place immediately on ice for 2 minutes, centrifuge at 12,000 rpm (~13,400 × g) for 10 minutes, take the supernatant and place in another sterile EP tube, label it, and store at -20°C.2. Testing procedures:2.1. Remove the TB Genotyping Kit HV-3, allow the liquid to equilibrate to room temperature, mix by shaking slightly 3-4 times, and then centrifuge at 12,000 rpm (~13,400 x g) for 5 seconds to allow the capped liquid to fall back into the tube.2.2.Three-locus VNTR typing: strains with identical results at 12 loci need to be further VNTR typed, i.e., the following four loci are added for comparison.1）PCR amplification: the reaction system was 20 µl. 19 µl of PCR Mix of VNTR3820, VNTR4120, and VNTR3232 were added to each PCR tube, 1 µl of DNA template was added, and mixed well.2）Amplification conditions:3) Gel preparation and electrophoresis:a: Notes:Important! Positive (H37Rv strain DNA) and negative controls (deionized water) need to be set up for each experiment.Key! This experiment is based on agarose gel electrophoresis to interpret the genotype of VNTR locus, therefore, in order to make the results accurate, it is necessary to follow the unified standard operation in this step of electrophoresis, and the following points should be noted:a-1: The comb used for glue making is 18 holes.a-2: The two wells on the left and right sides of the gel were discarded due to the tendency to distort the bands during electrophoresis, affecting the interpretation of the results, or a negative control was spotted in one of the wells. The remaining 16 wells were divided into 12 samples, 3 DNA Markers and 1 positive control. The order of spotting was "1, 2, M, 3, 4, 5, 6, M, 7, 8, 9, 10, M, 11, 12, H37Rv", the numbers represent samples, and M represents DNA Marker.a-3: When PCR amplification products are subjected to the first electrophoresis and Marker I is used, the gel concentration is 1%, the voltage is 150 V, and the time is 100-120 min.a-4: If the amplification product fragment is too large (>1000bp) and needs to be electrophoresed again and Marker II is used, the gel concentration is 0.8%, the voltage is 150V and the time is 150 minutes.b: Gluing as well as the electrophoresis process:PCR amplification products were electrophoresed using a 1% agarose gel.To prepare 1% agarose gel, 12×12 cm gel tray was used to make the gel, each gel was 80 ml.b-1: Weigh 0.8g of agarose, add 80ml of 0.5×TBE, weigh it on the balance and put it into the microwave oven, heat it on high for 2-3 minutes to make the agarose dissolve completely, shake it well, and observe it as a homogeneous and transparent solution without particles, then weigh it again on the balance and make up the appropriate amount of double-distilled water to keep the concentration of the gum unaffected.b-2: When the melted gel was cooled to about 55°C add 4 µl of ethidium bromide (10ug/ml) and gently swirl to mix well. The gel was made with an 18-tooth comb and the warm gel was poured into a 12 × 12 cm gel tray.b-3: Allow the gel to completely set (40 minutes at room temperature), carefully pull out the comb, remove the tray, and place it in the electrophoresis tank. Add 0.5× TBE buffer to the electrophoresis tank, not exceeding the gel surface by 1-2mm.b-4: Sample electrophoresis: add 12 samples to each gel (the topmost wells are not sampled), add 3-5µl PCR products to each well, and at the same time add three 5µl DNA MarkerⅠ to each gel. The voltage is 150V and the electrophoresis time is 100-120 minutes. This step is the key to the accuracy of the final readings of each point, and needs to be operated uniformly according to this standard.b-5: Some loci have amplification products greater than 1000bp in clinical strains, and these amplification products were then electrophoresed using 0.8% agarose gel, with DNA Marker II added as a control for the band size, voltage 150V, electrophoresis time 150 minutes.4) Results display:5) Analysis of results:a. If the genotypes of the three highly variable loci are also the same in different strains, they can be identified as clustered strains;b. If the high variant readings are highly similar, i.e., only 1-2 high variant sites are different, they need to be combined with epidemiologic data to identify if they are clustered strains;c. If all 3 high variant loci are genotypically discordant, identify as a single strain.Appendix 1: Rules for reading VNTR lociAppendix 2: VNTR locus repeat unit readout table... Read More |