| Description | Inquire | Inquire | Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Product introduction：Product introduction：Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) has certain applicability for live cells and fixed cell cycle detection. For different types of cells, whether it is applicable or not needs to be determined after testing. Cell Cycle Assay Kit Plus ( Cell Cycle Assay Kit Plus ) uses RedNucleus I staining to detect cell cycle. RedNucleus I is a far-infrared nucleic acid dye with cell membrane permeability, which can quickly enter living cells, specifically bind to DNA, and perform cell cycle detection on living cells without RNase digestion. Compared with the traditional PI staining method, the cells do not need to be broken or fixed, and the operation is simpler. RedNucleus I is a fluorescent dye of double-stranded DNA, and the fluorescence intensity after binding to double-stranded DNA is proportional to the content of double-stranded DNA. The intracellular DNA content can be measured by flow cytometry, and then the cell cycle analysis can be carried out according to the distribution of DNA content. After RedNucleus I staining, assuming that the fluorescence intensity of G0 / G1 phase cells is 1, the theoretical value of the fluorescence intensity of G2 / M phase cells containing two copies of genomic DNA is 2, and the fluorescence intensity of S phase cells undergoing DNA replication is between 1-2. In addition, RedNucleus I is compatible with dyes such as Horizon BV / BUV, FITC and R-PE, and can be periodically detected after sample staining.The kit is usually used to detect the cell cycle of cultured adherent or suspended cells. If it is used for cell cycle detection of tissues, the tissues must be digested into a single cell state.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. this product is applicable to the detection of living cells and fixed cell cycle with certain limitations. Whether it is applicable to different types of cells needs to be determined after testing. If fixation is needed, it is recommended to use ice bath pre cooling 75-80% ethanol -20 ℃ to fix cells overnight. 3. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 4. for your safety and health, please wear experimental clothes and disposable gloves.Instruction： Experimental materials ( self-provided )：①cell lines or other cell samples ( self-prepared ) ；②This kit ; ③ trypsin ( self-prepared ) ;④ Cell culture medium containing FBS ( self-prepared ) ; Experimental procedure： 1.Preparation of cell samples : ( 1 ) ( This step is for adherent cells, if suspended cells, can be carried out directly step ( 2 ) ) Digest cells with trypsin, add cell culture medium, gently blow away cells, collected into the centrifuge tube. Note : The number of cells on the machine needs to reach 50,000 and above, so the initial number of cells collected needs to be sufficient. ( 2 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. Carefully remove the supernatant, add about 1 mL of ice bath pre-cooled 1 × staining buffer ( 10 × staining buffer diluted with diH2O at 1 : 10 ), re-suspend the cells. Repeat once. ( 3 ) Centrifuged about 1000 g for 3-5 min to precipitate cells. After the supernatant was discarded, 1 mL of culture medium was added to re-suspend the cells ( for fixed cells, 1 × PBS can also be used to re-suspend ). Gently flick the bottom of the centrifuge tube to properly disperse the cells to avoid cell aggregation. 2.Staining : 4 µL of RedNucleus I staining solution was added to each tube of cell samples, slowly and fully mixed, and incubated at room temperature in dark for 20 min ( or incubated at 37 ° C in dark for 5-10 min ). The optimal incubation time of different cells is different, and the staining time can be adjusted and optimized according to the actual staining effect to obtain a more ideal staining effect. 3.Flow cytometry detection and analysis : Excited at 638 nm by flow cytometry, it is recommended to detect in RL3 or FL4 channels, or use RL1 and RL2 channels. Cell DNA content analysis and light scattering analysis were performed using appropriate analysis software.Scope of application：Cell cycle detection... Read More | CFDASE cell proliferation and tracking detection kit is a kit for cell proliferation and tracking detection based on CFDA se. This kit is composed of CFDASE powder, solvent and staining buffer. CFDASE is a derivative of fluorescein diacetate (FDA), which has cell membrane permeability and CFDASE cell proliferation and tracking detection kit is a kit for cell proliferation and tracking detection based on CFDA se. This kit is composed of CFDASE powder, solvent and staining buffer. CFDASE is a derivative of fluorescein diacetate (FDA), which has cell membrane permeability and does not have fluorescence luminescence. When CFDASE penetrates the cell membrane into living cells, it can be catalysed by esterases in the cytosol to produce carboxyfluorescein succinimidyl ester (CFSE), which can emit strong green fluorescence, cannot penetrate the cell membrane, and can remain intact in the cell. CFSE can also spontaneously and irreversibly covalently bind to intracellular amino groups to couple to cellular proteins. Meanwhile, the excess and uncoupled CFDASE returned to the extracellular medium by passive diffusion and was cleared by subsequent washing steps. The fluorescence of non dividing cells labeled by CFDASE is very stable, and the stable labeling time can reach several months, so it is very suitable for cell community analysis. The fluorescence of CFDASE labeled cells is very homogeneous, which is superior to other cell tracking fluorescent probes used previously, such as PKH26, and the fluorescence distribution of the divided progeny cells is also very uniform. In the process of cell division and proliferation, CFSE labeled fluorescence can be evenly distributed to the two progeny cells, and the fluorescence intensity becomes half of the parental cells. According to the fluorescence intensity, flow cytometer (FL1 channel) can detect undivided cells, cells that divide once (1 / 2 of the fluorescence intensity), twice (1 / 4 of the fluorescence intensity), three times (1 / 8 of the fluorescence intensity), and cells that divide more times. CFDASE can detect up to eight or more cleavages. CFDASE labeled cells can be used for proliferation studies in vitro and in vivo, and have the function of not staining adjacent cells. CFDASE is most commonly used to detect the proliferation of lymphocytes, and can also be used to detect the proliferation of fibroblasts, NK cells and other cells. CFDASE labeled cells showed green fluorescence. In addition to flow cytometry to detect cell proliferation, fluorescence microscopy can also be used for homogeneous staining of cell tracking observation.Components:ComponentsC598182-20TC598182-500TA. CFDA SE1 tube1 tubex5B.CFDA SE solvent20 µL500 µLC.10x CFDA SE Buffer1 mL x250 mLMatters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. CFDA and Se are easily hydrolyzed and will deteriorate quickly in aqueous solution. Please avoid contact with water during use. Contact with water during the process of labeling cells is within the permitted range. 3. CFDA se solvent will solidify at lower temperatures such as 4 º C and ice bath and stick to the bottom, wall or cover of the centrifugal tube. It can be used after incubating in a 20-25 º C water bath for a while until it is completely dissolved. 4. this kit optimizes the CFDA se staining system, but users are advised to explore the optimal working concentration and staining time according to their own cell type, culture conditions and application direction. Different cells have different lactonase activities, so the staining effect is different. 5. fluorescent dyes have quenching problems. Please avoid light during operation to slow down fluorescence quenching. 6. for your safety and health, please wear experimental clothes and disposable gloves.Usage method:1. Preparation of reagents(1) Preparation of CFDA SE storage solution: Take one tube of CFDA SE provided in the reagent kit and restore it to room temperature. Instantly centrifuge to allow the powder to fully settle to the bottom of the tube. Add 100 µ L CFDA SE solvent (add 20 µ L CFDA SE solvent) to it and dissolve it thoroughly to prepare CFDA SE storage solution (1000 ×). Prepared CFDA SE storage solution, stored at -20 ℃ in the dark, with a shelf life of two months- Storing at 70 ℃ in the dark can extend the usage time appropriately.(2) Preparation of CFDA SE Buffer: Dilute 10 x CFDA SE Buffer to 1 x with sterile cell culture grade water as needed. The prepared 1 × CFDA SE Buffer can be stored at 4 ℃ and can be stored at -20 ℃ if not in use for a long time.2. Marking and detection(1) Centrifuge the collected cells, use 1 mL 1 × CFDA SE Buffer to re suspend the cells in a 15 mL centrifuge tube, and adjust the cell concentration to 1-5 × 106 cells/mL.(2) Preparation of CFDA SE working solution: Dilute the CFDA SE storage solution (1000 ×) with 1 × CFDA SE Buffer to 2 ×.(3) Staining: Add 1 mL of CFDA SE working solution (2 x) to 1 mL of cell suspension to be labeled, invert and mix well, and incubate at 37 ℃ for 10 minutes.(4) Immediately add 5 times the volume of preheated complete culture medium (including serum) to the centrifuge tube, invert and mix well to terminate the labeling reaction.(5) Centrifuge at 1000 rpm for 5 minutes at room temperature to remove the supernatant, then wash once with 5-10 mL of complete culture medium.(6) Add 5-10 mL of complete culture medium and incubate at 37 ℃ for 5 minutes to promote the residence of CFDA SE in the cells and the entry of unreacted CFDA SE into the complete cell culture medium. Centrifuge at 1000 rpm for 5 minutes at room temperature to remove the supernatant and complete the final wash.(7) Subsequently, the cells can be cultured using the normal cultivation method. The labeling effect can be directly observed under a fluorescence microscope, or cell proliferation can be detected by flow cytometry after appropriate cultivation time, showing green fluorescence. The labeled cells can also be used for transplantation in live animals and for fluorescence tracing.Note: a If cell fixation is required, use aldehyde fixatives such as 4% paraformaldehyde to fix at room temperature for 15 minutes; If additional labeling such as antibody labeling is required afterwards, please permeabilize the cells with ice acetone for 10 minutes. b. The optimal labeling concentration and incubation time for CFDA SE vary for different cells. The initial experiment can be conducted according to the experimental steps. If the effect is not satisfactory, it is recommended to adjust the staining concentration and incubation time to achieve the best labeling effect.Scope of application：Cell proliferation assay... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |