| Description | Inquire | Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm.Annexin V ( annexin-V ) is a Ca2 + dependent phospholipid binding protein with a molecular weight of 35-36 KD, which can selectively bind to phosphatidylserine ( PS ). Phosphatidylserine ( PS ) is mainly distributed in the inner side of the cell membrane, that is, the side adjacent to the cytoplasm. In the early stage of apoptosis, different types of cells will turn phosphatidylserine out to the cell surface and expose to the extracellular environment. At this time, using Annexin V labeled with fluorescent protein PE, that is, Annexin V-PE, combined with phosphatidylserine ( PS ), the eversion of phosphatidylserine, an important feature of apoptosis, can be directly detected by flow cytometry. Normal cells will not be stained by Annexin V-PE, apoptotic or necrotic cells will be stained by Annexin V-PE. Annexin V-PE can be used in combination with partially non-permeable nuclear dye ( 7-AAD / PI ) to distinguish cells at different stages of apoptosis. RedNucleus II provided in this kit is a far-red dye that belongs to an anthraquinone compound and cannot penetrate the intact cell membrane of living cells and early apoptotic cells. It is non-permeable, but can quickly stain the nucleus / dsDNA in dead and permeable cells. RedNucleus II is an ideal substitute for propidium iodide ( PI ) and 7-AAD.Combined with Annexin V-PE, it has better spectral characteristics without compensation regulation : it is not excited by ultraviolet light and does not overlap with PE / PE homologues, so it can be combined with FITC, PE and purple fluorescent dyes for multicolor analysis. When combined with Annexin V-PE, RedNucleus II was excluded from living cells and early apoptotic cells, while late apoptotic cells and dead cells were double-positive for Annexin V-PE and RedNucleus II. Annexin V-PE / RedNucleus II apoptosis detection kit can be detected by flow cytometry or other fluorescence detection equipment. Components: Components A598354(10T) A598354(50T) A598354(100T) A. 1×Annexin V Combining buffer solution 10 mL 50 mL 50 mL×2 B. Annexin V-PE 50 µL 250 µL 500 µL C. RedNucleus II 100 µL 500 µL 1 mLProduct parameters：Annexin v-pe:ex/em=488/578 nmrednucleus ii:ex/em=635/695 NMUsage method:1. Experimental design: Blank tube: Negative control group cells, without Annexin V-PE/RedNucleus II. Used to regulate voltage.Single staining tube: Positive control group cells were treated with Annexin V-PE alone/RedNucleus II alone. Used for adjusting compensation.Detection tube: Add Annexin V-PE/RedNucleus II to the processed cells. After adjusting the voltage compensation using blank tubes and single dye tubes, obtain the required flow data.2. Collect cells(1) For suspended cells:a. After inducing cell apoptosis, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS, and count them.Note: PBS resuspension cannot be omitted. The process of PBS resuspension also serves to wash cells, ensuring the subsequent binding of Annexin V-PE.b. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. c. Add 5 µ L Annexin V-PE and mix gently.d. Add 5 µ L of RedNucleus II staining solution and mix gently.e. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.(2) For adherent cells:a. Suck out the cell culture medium into a suitable centrifuge tube, wash the adherent cells with PBS once, and add an appropriate amount of trypsin cell digestion solution (without EDTA) to digest the cells. Incubate at room temperature until gently blowing can remove the trypsin cell digestion solution when the adherent cells are blown down. Overdigestion of pancreatic enzymes should be avoided.Note: For adherent cells, the trypsin digestion step is crucial. If the trypsin digestion time is too short, cells need to be blown hard to detach, which can easily cause damage to the cell membrane and lead to false positives of cell necrosis; If the digestion time is too long, it can also cause cell membrane damage and false positives of cell necrosis, and even affect the binding of phosphatidylserine and Annexin V-PE on the cell membrane, thereby interfering with the detection of cell apoptosis.b. Add the cell culture medium collected in the previous step, gently blow down the cells, transfer them to a centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, collect the cells, gently resuspend the cells in PBS and count them.Note: Adding the cell culture medium from the previous step is very important. On the one hand, it can collect cells that have already been suspended and undergone apoptosis or necrosis. On the other hand, the serum in the cell culture medium can effectively inhibit or neutralize residual trypsin. The residual trypsin will digest and degrade the subsequently added Annexin V-PE, leading to staining failure.c. Take 5 × 104-1 × 105 resuspended cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, and add 100 µ L of 1 × Annexin V binding buffer to gently resuspend the cells. d. Add 5 µ L Annexin V-PE and mix gently.e. Add 5 µ L of RedNucleus II staining solution and mix gently.f. Incubate at room temperature (20-25 º C) in the dark for 15 minutes. Aluminum foil can be used to avoid light. During the incubation process, cells can be resuspended 2-3 times to improve staining efficiency.3. Result analysis:(1) Flow cytometry detection:a. After incubation, 400 µ L of 1 × Annexin V binding buffer can be directly added to resuspend the cells, and immediately detected on the machine. Annexin V-PE is excited by 488 nm/566 nm laser, and the fluorescence emission spectrum is detected at 578 nm (BL2 (FL2)/YL1 channel), while the RedNucleus II channel emission spectrum is approximately at 695 nm (RL1 (FL4) channel).b. On the scatter plot of the bivariate flow cytometer, live cells are shown in the lower left quadrant, which is (Annexin V-PE -/RedNucleus II -); The lower right quadrant represents early apoptotic cells, which are (Annexin V-PE+/RedNucleus II -); The upper right quadrant represents necrotic and late stage apoptotic cells, which are (Annexin V-PE+/RedNucleus II+); The upper left quadrant displays naked nuclear cells, which are (Annexin V-PE -/RedNucleus II+).(2) Fluorescence microscopy detection:a. Centrifuge at 1000 rpm for 5 minutes, collect cells, and gently resuspend them in 400 µ L of 1 × Annexin V binding buffer. Transfer the cells to a 96 well plate and settle for a moment or perform cell smear, then observe under a fluorescence microscope.b. Annexin V-PE is compatible with PE filters. RedNucleus II can use a far red long pass filter.Matters needing attention：1. please centrifuge the product to the bottom of the tube immediately before use, and then conduct subsequent experiments. 2. to reduce the process of apoptosis, the incubation process can be operated on ice, but the incubation time should be extended to at least 30 min. 3. as apoptosis is a rapid process, it is recommended that samples be analyzed within 1 h after staining. 4. for adherent cells, digestion is a key step. If there are floating cells when adherent cells induce apoptosis, the floating cells and adherent cells should be collected and stained. Handle adherent cells with care to avoid artificial damage to cells. The trypsin digestion time is too short, and the cells need to be blown hard to fall off, which is easy to cause damage to the cell membrane and excessive intake of rednucleus II; If the digestion time is too long, the cell membrane is also prone to damage, and even affect the binding of phosphatidylserine and annexin v-pe on the cell membrane. When digesting, spread pancreatin on the bottom of the well plate, fully contact the pancreatin with the cells when shaking gently, then pour out most of the pancreatin, use the remaining small amount of pancreatin to digest for a period of time, and terminate when the gap between cells increases and the bottom of the bottle is spotted. Try not to use EDTA in the digestive juice, which will affect the binding of annexin V to PS. 5. after the adherent cells are digested with trypsin, it is recommended to stain after recovering in the optimal culture conditions and medium for about 30 min to avoid false positives. 6. in order to avoid losing cells when washing cells, you can use a large tip over a small tip to aspirate. 7. the optimal concentration of dye is determined by the specific experimental requirements. 8. fluorescent dyes have quenching problems. Please try to avoid light during storage and use to slow down fluorescence quenching. 9. for your safety and health, please wear experimental clothes and disposable gloves.Scope of application：Early apoptosis detection, annexin V Kit... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | This reagent kit is based on TRIzon's improved columnar total RNA extraction kit. This product can be extracted from animal groupsExtract total RNA from samples such as textiles, plant materials, various microorganisms, and cultured cells. Firstly, the cracking solution is fully cracked This reagent kit is based on TRIzon's improved columnar total RNA extraction kit. This product can be extracted from animal groupsExtract total RNA from samples such as textiles, plant materials, various microorganisms, and cultured cells. Firstly, the cracking solution is fully cracked andHomogenized samples, in their unique high salt state, RNA specifically binds to silicon matrix membranes, greatly reducingEffectively removing organic solvent contamination while removing protein contamination, resulting in higher purity and quality of RNA. bookThe product can quickly extract total RNA from various cells or tissues, and can process 30-50 mg of tissue or 5 × 10 ⁶ cells each time,Can handle multiple different samples simultaneously. If it is an RNA experiment that is very sensitive to trace amounts of DNA, the residual DNA can be utilizedUsing DNase without RNase for digestion and removal on the column, the extracted RNA can be directly applied to RT-PCR Experiments such as Northern Blot, Dot Blot, and in vitro translation. U665516 Component 50 T Storage U665516A DNase I 1000 U -20℃. Avoid freeze/thaw cycle. U665516B 10×Reaction Buffer 1000 µL -20℃. Avoid freeze/thaw cycle. U665516C TRIzon Reagent 60 mL 2-8℃. Protect from light. U665516D TRIzon PaI™ 10 mL 2-8℃. Protect from light. U665516E Buffer RW1 40 mL RT U665516F Buffer RW2 (concentrate) 11 mL RT U665516G RNase-Free Water 10 mL RT U665516H Spin Columns RM with Collection Tubes 50 sets RT U665516I RNase-Free Centrifuge Tubes (1.5 mL) 50 EA RTPreparation and important precautions before the experiment:1.To prevent RNase pollution, attention should be paid to the following aspects:1) RNase's plastic products and gun heads to avoid cross contamination.2) Prepare the solution using water without RNase.3) Operators should wear disposable masks and gloves, and change gloves frequently during the experiment.2. The sample should avoid repeated freezing and thawing, otherwise it will affect the yield and quality of RNA extraction.3. If TRIzon Reagent is found to have precipitates before use, it can be dissolved in a water bath at 56 ℃ for a few minutes.Before the first use, anhydrous ethanol should be added to Buffer RW2 according to the instructions on the reagent bottle label.5. All centrifugation steps should be carried out at room temperature unless otherwise specified, and all operation steps should be carried out quickly.Usage：1. Sample processing1a. Organization: 30-50 mg of tissue is thoroughly ground in liquid nitrogen and 1 mL of TRIzon Reagent is added, or 1 mL of TRIzon Reagent is added to the tissue sample and homogenized. Attention: The sample volume should not exceed 10% of the volume of TRIzon Reagent.2a. Single layer cell culture: Remove the culture medium and add an appropriate amount every 10 cm ² Add 1 mL of TRIzon Reagent.3a. Cell suspension: Collect cells by centrifugation. Add 1 mL of TRIzon Reagent to every 5 × 10 µ m cell.2. After adding TRIzon Reagent, repeatedly blow a few times to fully crack the sample. Leave at room temperature for 5 minutes to completely separate the protein nucleic acid complex.3. Add 200 to every 1 mL of TRIzon Reagent µ LTRIzon PaI ™， Cover the tube tightly, vigorously shake for 15 seconds, and let it sit at room temperature for 2 minutes.4. Centrifuge at 4 ℃ 12000 rpm (~13400 × g) for 10 minutes. At this time, the sample is divided into three layers: the red organic phase, the middle layer, and the upper colorless aqueous phase. RNA is mainly in the upper aqueous phase. Move the upper aqueous phase to a new RNase Free centrifuge tube (provided).5. Add an equal volume of 70% ethanol (prepared without RNase water) to the obtained aqueous solution, invert and mix well.6. Add all the solutions obtained in the previous step to the spin columns RM that have been loaded into the collection tube. If the solution cannot be added at once, it can be transferred in multiple batches. Centrifuge at 12000 rpm for 20 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.7. Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 20 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.8. Preparation of DNase I mixture: Take 52 µ LRNase Free Water, add 8 to it µ L 10 x Reaction Buffer and 20 µ L DNase I (1 U/ µ L) Mix well and prepare to a final volume of 80 µ The reaction solution of L.9. Directly add 80 µ L DNase I mixture to the adsorption column and incubate at 20-30 ℃ for 15 minutes.10. Add 350 to the adsorption column µ L Buffer RW1, centrifuge at 12000 rpm for 1 minute, discard the waste liquid, and place the adsorption column back into the recovery manifold.11. Add 500 to the adsorption column µ L Buffer RW2 (check if anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 20 seconds, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube.12. Repeat step 11.Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid from the collection tube. Place the adsorption column at room temperature for a few minutes and thoroughly air dry. Attention: The purpose of this step is to remove residual ethanol from the adsorption column, which will affect subsequent enzymatic reactions (enzyme digestion,. )PCR, etc.14. Place the adsorption column in a new RNase free centrifuge tube and add 30-50 to the middle of the adsorption column µ Place RNase Free Water at room temperature for 1 minute, centrifuge at 12000 rpm for 1 minute, collect RNA solution, and store RNA at -70 ℃ to prevent degradation.Attention:1) The volume of RNase Free Water should not be less than 30 µ L. Small volume affects the recovery rate.2) If you want to increase RNA production, you can use 30-50 µ Repeat step 14 for the new RNase Free Water.3) If you want to increase the RNA concentration, you can add the obtained solution back to the adsorption column and repeat step 14... Read More |