| Description | Inquire | DescriptionThe plasma protein lecithin:cholesterol acyltransferase (LCAT) catalyzes the transfer of an acyl group from the sn2 position of phosphatidylcholine to the 3-hydroxyl group of cholesterol forming cholesteryl ester. This activity occurs on the surface of high density lipoprotein (HDL) and DescriptionThe plasma protein lecithin:cholesterol acyltransferase (LCAT) catalyzes the transfer of an acyl group from the sn2 position of phosphatidylcholine to the 3-hydroxyl group of cholesterol forming cholesteryl ester. This activity occurs on the surface of high density lipoprotein (HDL) and the cholesteryl esters formed by LCAT are incorporated into the core of HDL.Preparation instructionsSuitable for high-throughput screening, mechanism of action studies and structureactivity relationship (SAR) work of LCAT in plasma and serumPrincipleThe LCFC-LCAT Acyltransferase Activity Assay is a fluorometric assay useful for measuring the acyltransferase activity of LCAT in serum or plasma. The method detects changes in LCAT free cholesterol (LCFC) levels in the sample without the use of c... Read More | Inquire | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product contentComponentY665957-1mlY665957-5ml2×GoldStar Probe Mixture1 ml5×1 mlProbe Primer Mix300 µl5×300 µlHuman DNA Standard（100 ng/µl）100 µl5×100 µl50×High ROX40 µl200 µlProduct IntroductionThis product is a real-time Product contentComponentY665957-1mlY665957-5ml2×GoldStar Probe Mixture1 ml5×1 mlProbe Primer Mix300 µl5×300 µlHuman DNA Standard（100 ng/µl）100 µl5×100 µl50×High ROX40 µl200 µlProduct IntroductionThis product is a real-time fluorescence quantitative PCR kit for detecting the concentration of human male Y chromosome, including carefully optimized PCR reaction solution, primer mixture and standards, especially suitable for the quantitative detection of precious and micro DNA samples. The kit adopts a new efficient and fast hot-start amplification enzyme GoldStar Taq DNA Polymerase, which effectively avoids non-specific amplification caused by non-specific binding of primers and templates or primer dimerization at room temperature. This product realizes accurate quantification of Y chromosome and can be applied in various fields such as genetic mapping, species polymorphism research, disease gene localization, paternity testing and forensic analysis.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument.Instruments that do not require ROX calibration: Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96, etc.Instruments requiring Low ROX calibration: ABI Prism7500/7500 Fast, QuantStudio®3 System, QuantStudio®5 System, QuantStudio®6 Flex System, QuantStudio®7 Flex System, ViiA 7 System, Stratagene Mx3000/Mx3005P, Corbett Rotor Gene 3000, and others.Instruments requiring High ROX calibration: ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, etc.Note: High Rox and Low Rox are formulated as described in Method of Use 3.Scope of applicationThis product is suitable for quantitative testing of male Y chromosome DNA in scientific research, clinical, forensic medicine and paternity testing.Usage1. Amplification template preparationThe library samples to be detected were diluted with TE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA), and the concentration after dilution was as close as possible to the range of 0.05-10 ng/µL. 4°C on ice was set aside.2. Standard dilution: according to the following table, firstly dilute Human DNA Standard (100ng/uL) with TE to make 5 standards of different concentrations according to the table below. 10ng/µL of DNA Standard 1 (Std.1) can be stored stably at -20℃ for 1 month; Std2-5 can only be used on the same day, and should be placed at 4℃ or on ice when not in use for the time being after preparation. When Std2-5 are not used temporarily after preparation, they should be stored at 4℃ or on ice.Standard sampleCorresponding concentration(ng/µl)Minimum Dilution Volume (Unit：µl）Std.11010 [100 ng/µl DNA Standard]+ 90 TEStd.22.520 [Std. 1] +60 TEStd.30.62520 [Std. 2] +60 TEStd.40.1562520 [Std. 3] +60 TEStd.50.039062520 [Std. 4] +60 TE3. qPCR reaction system preparationBefore preparation, the cryopreserved reagents to be used were completely melted and mixed by inverting several times, then centrifuged briefly and prepared. Standards and templates were diluted as described above and prepared.The base reaction system for 20 µL was as follows:Reagent20 µl Reaction system2×GoldStar Probe Mixture10 µlProbe Primer Mix3 µlTemplate4 µlddH₂O3 µlNote: High ROX model: add 1 µL of 50×High ROX per 50 µL of reaction system; Low ROX model: add 1 µL of 50×High ROX per 500 µL of reaction system.A sufficient amount of reaction system mixture was prepared according to the need, and after the reaction system was prepared and mixed thoroughly, it was added to the reaction wells in a volume of 16 µl per well. Then add the prepared standards and diluted samples into the corresponding reaction wells, the amount of addition is 4µL/well. TE was added to the blank control tube, and the same amount was added at 4 µL/well.It is recommended to use 20 µL for the reaction, if you need to perform a smaller system reaction, reduce the system components in equal proportion.4. qPCR reaction programThe PCR mix of this kit contains a FAM fluorescent probe for the target gene and a VIC fluorescent probe with internal reference to Internal PCR Control (IPC). qPCR program with dual fluorescence of hydrolyzed probes needs to be selected for the assay. Please follow the instructions of the instrument used to set up the qPCR program, and the PCR temperature conditions are as follows:1. Standard curve productionThe standard curve was plotted with reference to the Excel sheet for data processing. The correlation coefficient R2 of the standard curve should be not less than 0.98, and the slope should be located between -3.1 and -3.6 when the Ct value is used as the longitudinal coordinate. If the parameters of the standard curve are unreasonable, it is recommended to repeat the experiment.DNA Standard NameDNA Standard Concentration（ng/µL）DNA Standard 110DNA Standard 22.5DNA Standard 30.625DNA Standard 40.15625DNA Standard 50.03906252. Analysis of results and calculation of concentrationsThe Ct difference between experimental replicate wells for FAM signaling of the target gene should be no more than 0.3, otherwise invalid data need to be deleted or the experiment needs to be repeated, do not use Ct outside the valid Ct range of the standard curve to calculate the concentration of the sample.For specific calculations, please refer to the data processing Excel for this product.If the FAM signal is abnormal, the VIC signal of the internal reference Internal PCR Control (IPC) needs to be analyzed to confirm whether the PCR reaction process is abnormal. If the Ct value of the sample null VIC is significantly larger than that of the standard or blank control wells, it means that the sample inhibits the PCR reaction.matters needing attention1. Before testing, these instructions should be read in detail. It should be operated by personnel with professional experience or qualified by training.2. For use, please mix gently by turning up and down, avoid foaming as much as possible, and use it after centrifugation for a short period of time.3. Avoid repeated freezing and thawing of the product, repeated freezing and thawing may degrade the performance of the product.4. When preparing the reaction solution, please use new or non-contaminated tips and centrifuge tubes to prevent contamination as much as possible... Read More |