| Description | Inquire | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | DescriptionThe plasma protein lecithin:cholesterol acyltransferase (LCAT) catalyzes the transfer of an acyl group from the sn2 position of phosphatidylcholine to the 3-hydroxyl group of cholesterol forming cholesteryl ester. This activity occurs on the surface of high density lipoprotein (HDL) and DescriptionThe plasma protein lecithin:cholesterol acyltransferase (LCAT) catalyzes the transfer of an acyl group from the sn2 position of phosphatidylcholine to the 3-hydroxyl group of cholesterol forming cholesteryl ester. This activity occurs on the surface of high density lipoprotein (HDL) and the cholesteryl esters formed by LCAT are incorporated into the core of HDL.Preparation instructionsSuitable for high-throughput screening, mechanism of action studies and structureactivity relationship (SAR) work of LCAT in plasma and serumPrincipleThe LCFC-LCAT Acyltransferase Activity Assay is a fluorometric assay useful for measuring the acyltransferase activity of LCAT in serum or plasma. The method detects changes in LCAT free cholesterol (LCFC) levels in the sample without the use of c... Read More | This kit is used to extract miRNAs from various animal tissues, plant tissues and cells. The extracted miRNA molecule is complete and high purity, which is suitable for various molecular biology experiments such as Northern blot, real timepcr, miRNA microarray chip, in situ hybridization, This kit is used to extract miRNAs from various animal tissues, plant tissues and cells. The extracted miRNA molecule is complete and high purity, which is suitable for various molecular biology experiments such as Northern blot, real timepcr, miRNA microarray chip, in situ hybridization, RNase protection assay, etcComposition:Scope of application:Nucleic acid extraction and purificationInstruction:1.Experimental preparation:1.1.All reagents were prepared with DEPC-treated solvents. Please use RNase-free tip and centrifuge tube to avoid RNA degradation by RNase during extraction.1.2.70 % ethanol, -20C pre-cooling.2.Operational procedure:There is a slight difference in the operation of miRNA extraction from different samples. The specific steps are as follows :【 Extraction of miRNA from animal tissues】1.Take 20-40 mg tissue, transfer to a pre-cooled mortar, and add liquid nitrogen to grind into powder.Please click below to describe the amount of organization used :①RNA-rich tissue ( e.g. liver ) : no more than 30 mg②Tissues with low RNA content ( e.g., muscle ) : no more than 100 mg③When the amount of tissue used was less than 20 mg : the amount of R-I, R-II and isopropanol used was halved.④When the amount of tissue used was more than 40 mg : the use of R-I, R-II and isopropanol increased proportionally.2.Add 400 ul Buffer R-I, repeatedly aspirate 8-10 times with a syringe equipped with a 21-25 needle, and transfer to a 1.5 m : centrifuge tube ( provided in the kit ). 3.Add 150 µl BufferR-1l, swirl for 15-30 s, centrifuge at 12,000 X g for 5 min. [ Centrifugation at 4 °C is recommended ] 4.Take the supernatant to 1.5ml centrifuge tube, add 180 u anhydrous ethanol, mix evenly.5.The preparation tube was placed in a 2 m : centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and 12,000 X g was centrifuged for 1 min. [ 1 Centrifugation at 4 °C is recommended ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]6.Abandon the preparation tube, add 500µl isopropanol to the filtrate, and mix evenly.7.12,000Xg centrifuged for 10 min, discard the supernatant.8.Add 700µl 70 % ethanol ( pre-cooled at -20 °C ), centrifuged at 12,000Xg for 5min.9.The supernatant was discarded and dried at room temperature for 5-10 min.10.70 ul Buffer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute miRNA.【 Extraction of miRNA from plant tissue 】1.Take 30-150 mg tissue, transfer to a pre-cooled mortar, and add liquid nitrogen to grind into powder.Please click below to describe the amount of organization used :①Plant leaves : usually 10-80 mg② Plant fiber tissue : usually 100-150 mg③When the amount of plant leaf tissue was less than 30 mg : the amount of R-I, R-II and isopropyl alcohol used was halved.④When the amount of plant leaf tissue was more than 80 mg : the use of R-I, R-II and isopropanol increased proportionally.⑤When the amount of plant fiber tissue was more than 150 mg : the use of R-I, R-II and isopropanol increased proportionally.2.Add 400 ul BufferR-I, use a syringe with a 21-25 needle to repeatedly suck 8-10 times, and transfer to a 1.5mI centrifuge tube ( provided in the kit ). 3.Add 150 ul Buffer R-1I, vortex oscillation 15-30 s, 12.000 x g centrifugation 5 min. [ Centrifugation at 4 °C is recommended ]4.Take the supernatant to 1.5ml centrifuge tube, add 180 mountain anhydrous ethanol, mix evenly.The preparation tube was placed in a 2 mI centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and 12.000 xg was centrifuged for 1 min. It is recommended to centrifuge at 4 °C ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]Abandon the preparation tube, add 500µl isopropanol to the filtrate, and mix evenly.7.12,000xg high heart for 10 min, discard the supernatant.8.Add 700 ul 70 % ethanol ( -20 °C precooling ), 12,000 xg centrifuge for 5 min.9.The supernatant was discarded and dried at room temperature for 5-10 min.10.70 ul Buffer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute miRNA.【miRNA extraction from cells】Steps 1-3 According to the different ways of cell culture, two experimental methods, a or b, can be selected.a. Suspension cultured animal cells or cell suspension obtained from petri dishes or culture flasks or freshly isolated animal tissue single cell suspension :1a.Collect 2X 10 * -1X 10 ' cells, centrifuge 2,000Xg for 5 min, discard the supernatant ;2a. Add 400 µl Buffer R-I, repeatedly draw 8-10 times with a syringe containing 21-25 needles, and transfer to a 1.5 mI centrifuge tube ( provided in the kit ) ;3a. Add 150µl Buffer R1I, vortex oscillation 15-30s, 12.000Xg centrifugal 5min. [ build at 4 °C centrifugal ].b. Cells cultured on 96-well L, 24-well, 12-well or 6-well plates :Cells were collected from 96-well, 24-well, 12-well or 6-well culture plates, and the medium was discarded as much as possible, and 400 u / well Buffer R-I was added to each well, and the pipette gun was used to blow up and down 8-10 times ;2b.Transfer the above cell suspension to a 1.5ml centrifuge tube ( provided in the kit ), and repeatedly draw 8-10 times with a syringe containing 21-25 needles ;3b. Add 150 µl Bufflr R-II, swirl for 15-30 s, centrifuge for 5 min at 12,000 × g. [ Recommended at 4 °C ]4.Take the supernatant to 1.5ml centrifuge tube, add 180 mountain anhydrous ethanol, mixing evenly.5.The preparation tube was placed in a 2 ml centrifuge tube ( provided in the kit ), the mixture in step 4 was transferred to the preparation tube, and centrifuged at 12.000 Xg for 1 min. [ 1 Centrifugation at 4 °C is recommended ; 2 miRNA in the filtrate, pay attention to preserve the filtrate. ]6.Abandon the preparation tube, add 500 u of isopropanol to the filtrate, and mix evenly.7.12,000Xg high heart for 10 min, discard the supernatant.8.Add 700µ70 % ethanol ( pre-cooled at − 20 °C ), centrifuged at 12,000 × g for 5 min.9.Abandon the supernatant, dry at room temperature for 5 - 10 min.10.70 ul Bufer TE ( nucdease-free ) or RNase-free water was added to the centrifuge tube to elute mRNA.3.Flow chartMatters needing attention:Buffer R-I contains irritating compounds, when operating to wear latex gloves and glasses, to avoid contamination of the skin, eyes and clothes, be careful not to inhale the nose and mouth. If the skin, eyes, to immediately rinse with a lot of water or saline, if necessary, seek medical advice... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More |