| Description | Inquire | Products B669892Component50 TStorageB669892ABuffer RCL3×260 mL2-8℃B669892BBuffer GR25 mLRTB669892CBuffer GL25 mLRTB669892DBuffer GW1 (concentrate)13 mLRTB669892EBuffer GW2 (concentrate)15 mLRTB669892FBuffer GE15 mLRTB669892GProteinase K50 mgRTB669892HProteinase K Storage Buffer5 Products B669892Component50 TStorageB669892ABuffer RCL3×260 mL2-8℃B669892BBuffer GR25 mLRTB669892CBuffer GL25 mLRTB669892DBuffer GW1 (concentrate)13 mLRTB669892EBuffer GW2 (concentrate)15 mLRTB669892FBuffer GE15 mLRTB669892GProteinase K50 mgRTB669892HProteinase K Storage Buffer5 mLRTB669892ISpin Columns DL with Collection Tubes50 setsRTProductsThis kit is suitable for the extraction of total DNA, including genomic DNA, mitochondrial DNA and viral DNA, from fresh or frozen whole blood (blood samplestreated with anticoagulants such as citrate, EDTA or heparin), plasma, serum, haematocrit brown and yellow layers, bone marrow, cell-free body fluids, etc. Theproduct can process 1-5 ml of whole blood, and can be purified to obtain sizes rangingfrom 100bp to 50kb. The purified DNA is of high yield and good quality, with maximumremoval of proteins, pigments, lipids and other inhibitory impurities, and can bedirectly used in PCR, fluorescence quantitative PCR, enzyme digestion and SouthernBlot.Self-contained reagent: anhydrous ethanol.Pre-experiment Preparation and Important Notes1. Add 5ml Proteinase K Storage Buffer to Proteinase K to dissolve it, and storeit at -20℃. Do not leave the prepared Proteinase K at room temperature for a longtime, and avoid repeated freezing and thawing to avoid affecting its activity.2. Repeated freezing and thawing of the sample should be avoided, as this may resultin smaller DNA fragments and a decrease in the amount of extracted DNA. 3.This kit can extract up to 1-5 ml of whole blood samples, if you need to extracta large number of blood samples, please use the blood genome non-column extractionkit. 4. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to theinstructions on the label of the reagent bottle before first use.5. Please check Buffer GL for crystallization or precipitation before use, if thereis any crystallization or precipitation, please put it in 56℃water bath to re-dissolve.6. If the downstream experiments are sensitive to RNA contamination, 4µl of DNaseFree RNase A (100mg/ml) can be added, RNase A is not provided in the kit, and canbe ordered separately from our company if needed.7. The Buffer RCL in the kit cannot be used further after turbidity.procedure1. Add 1-5 ml of blood sample to a centrifuge tube (supplied) and add 3 times thevolume of Buffer RCL and gently vortex or invert to mix.2. Centrifuge at 3000 rpm (~900 x g) for 10 minutes and carefully aspirate thesupernatant.3. Add 400 µl Buffer GR to the precipitate and resuspend the precipitate. Note: If the downstream assay is sensitive to RNA, add 4 µl of RNase A (100 mg/ml)solution, shake for 15 seconds, and leave at room temperature for 5 minutes.4. For 1-2 ml blood sample extraction, add 40µl Proteinase K to the above solutionand mix well; for 2-5 ml blood sample extraction, add 100µl Proteinase K to theabove solution and mix well.5. Add 400 µl of Buffer GL, mix upside down 15 times, and vigorously vortex andshake for at least 1 minute. Note: Do not add Proteinase K directly to Buffer GL.6. Incubate at 70°C for 10 minutes, during which time mixing was inverted severaltimes.Note: 1) If the solution is not completely clear, add appropriate amount of Proteinase K and incubate. Extend the incubation time until the solution is completely clear. 2) The yield of DNA has been maximized by 10 minutes of incubation, and continuedprolongation of the incubation time has no effect on DNA yield or purity.7. Add 400 µl of anhydrous ethanol and mix upside down 10 times. Centrifuge brieflyto concentrate the liquid on the walls and cap to the bottom of the tube.8. Add all of the solution obtained in the previous step to the Spin Columns DL inthe collection tube. If the solution cannot be added all at once, transfer it severaltimes. centrifuge at 12,000 rpm (~13,400 x g) for 1 minute, pour off the waste liquidfrom the collection tube, and put the column back into the collection tube.9. Add 500 µl of Buffer GW1 to the adsorption column (check that anhydrous ethanolis added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquidin the collection tube, and put the adsorption column back into the collection tube.Note: It is recommended that step 9 be repeated if the sample being extracted isthe blood genome of a species such as mice or monkeys from which hemoglobin isdifficult to remove.10. Add 500 µl Buffer GW2 to the adsorption column (check that anhydrous ethanolis added before use), centrifuge at 12,000 rpm for 1 minute, pour off the waste liquidin the collection tube, and put the adsorption column back into the collection tube.Note: Step 10 can be repeated if further DNA purity is required.11. Centrifuge at 12,000 rpm for 2 minutes and pour off the waste liquid in thecollection tube. Leave the adsorption column at room temperature for several minutesto dry thoroughly. Note: The purpose of this step is to remove residual ethanol from the adsorptioncolumn, which can interfere with subsequent enzymatic reactions (digestion, PCR,etc.)12. Place the adsorption column in a new centrifuge tube, add 50-200 µl of BufferGE or sterilized water to the middle of the adsorption column overhanging the column,leave it at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute,collect the DNA solution, and store the DNA at -20℃.Note: 1) If the downstream experiment is sensitive to pH or EDTA, you can use sterilized water for elution. The pH of the eluent has a great influence on theelution efficiency, if water is used as the eluent should ensure that its pH is7.0-8.5 (you can use NaOH to adjust the pH of the water to this range), and the elutionefficiency is not high when the pH is lower than 7.0.2) Incubation at room temperature for 5 minutes prior to centrifugation increasesyield.3) Re-elution with an additional 50-200 µl Buffer GE or sterilized water can increase the yield.4) If the final concentration of DNA is to be increased, the DNA eluate obtainedin step 12 can be re-spiked onto the adsorbent membrane and centrifuged at 12,000rpm. 1min; if the elution volume is less than 200µl, the final concentration of DNA canbe increased, but the total yield may be reduced. If the amount of DNA is less than1 µg, elution with 50 µl Buffer GE or sterilized water is recommended.5) Because DNA preserved in water is subject to acidic hydrolysis, for long-termstorage, it is recommended that it be eluted with Buffer GE and stored at -20℃... Read More | Product introduction：Used to isolate lymphocytes from human organsMatters needing attention：1. samples, reagents and experimental environment in the whole process shall be carried out at 20 ± 2 ℃. In order to obtain the best experimental results, it is best to carry out the Product introduction：Used to isolate lymphocytes from human organsMatters needing attention：1. samples, reagents and experimental environment in the whole process shall be carried out at 20 ± 2 ℃. In order to obtain the best experimental results, it is best to carry out the experiment within 2 h of sampling. The longer the sample is stored, the worse the cell separation effect is. The separation effect is even worse after the sample is placed for more than 6 h, or even cannot achieve the purpose of separation. 2. in this experiment, it is better not to use plastic products with high polymerization materials (such as polystyrene), but use non-static, low static ionization heart tubes and glass products without alkali treatment, because the electrostatic effect will lead to cell adhesion, and the surface of alkali treated glass will become rough, which will affect the effect of cell separation. 3. aspirating too many lymphocyte layers and separation liquid layers will cause the granulocytes at the junction of separation liquid to be aspirated, thus increasing the number of mixed granulocytes. 4. when the amount of separating solution is greater than that of tissue single cell suspension sample, the separation effect is better.Scope of application：Lymphocyte isolation... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligationProduct content Q665687Component100 TStorageQ665687AQuick T4 DNA Ligase (15 U/µL)100 µL-20℃. Avoid freeze/thaw cycle.Q665687B2×Quick Ligation Reaction Buffer5×200 µL-20℃. Avoid freeze/thaw cycle. Product IntroductionThe Quick Ligation Reaction Kit allows ligation of DNA sticky or flush ends in 5 minutes at room temperature (25°C). The kit contains Quick T4 DNA Ligase and 2×Quick Ligation Reaction Buffer optimized for fast and efficient DNA ligation.The ligation efficiency of Quick Ligation is equivalent to 1 hour of conventional ligation with T4 DNA Ligase. The Quick Ligation products can be used directly in routine bacterial transformation experiments.matters needing attention1. This kit enables most of the linkage reactions to reach the reaction endpoint within 5 minutes or less at 25°C. Increasing the reaction time will not enhance the reaction efficiency. If you use the rapid connection reaction after 1 hour, the conversion efficiency will be significantly reduced; if the rapid connection reaction at 25 ℃ overnight, the conversion efficiency will drop to 75%.2. 2×Quick Ligation Reaction Buffer contains ATP, which should be thawed on ice and mixed thoroughly before use. It is recommended to freeze the buffer in small tubes for the first time, so as to avoid repeated freezing and thawing, which will affect the efficiency of DNA ligation.3. Since T4 DNA Ligase contains glycerol, which is sticky and easy to hang on the wall, it is recommended to collect the liquid to the bottom of the tube by centrifugation for a short period of time before use, and the tip of the lance should not go too deep into the liquid surface when taking samples to avoid sticking to the tip of the lance and causing losses.4. If the quick ligation product is used for electrotransformation, the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation, and it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation.Usage1. The reaction solution was prepared according to the following system:*The amount of Insert DNA used: the molar ratio of Vector DNA and Insert DNA is generally 1:3-1:8, and the appropriate molar ratio of Vector DNA and Insert DNA can be selected according to the experimental situation.Calculation of DNA molar number: DNA molar number (nmol)=DNA mass (ng)/( 660daltons x number of inserted DNA bases bp).2. mix gently and centrifuge briefly. react at 25°C for 5 minutes.Note: The reaction time should not exceed 15 minutes, otherwise the connection efficiency will be reduced.3. Do not perform heat inactivation reactions. Centrifuge instantly and collect the solution from the wall to the bottom of the tube.Note: Heat inactivation significantly reduces transformation efficiency due to the presence of PEG in the buffer.4. After the reaction, store the DNA ligation product at 0-4℃, and then carry out transformation experiments; you can also store the DNA ligation product at -20℃.Note: When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.5. Heat shock the ligation product to transform 50 µl of receptor cells or take 1-2 µl of ligation product to electroshock transform 50 µl of receptor cells.Note: 1) When transforming by chemical method, do not add more than 10% of the volume of the receptor cell for the ligation product.(2) If the quick ligation product is used for electrotransformation, it is recommended to use a centrifugal column to purify the ligation product from DNA before electrotransformation because the PEG in the quick ligation reaction system will affect the efficiency of electrotransformation... Read More |