| Description | Inquire | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | DescriptionGreen LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatableDescriptionGreen LED Array for Photo KitAlysis high-throughput screening platform. For use with Photo KitAlysis Starter Kit (Z742612). User guide is provided in the below hyperlink.Photo KitAlysis Operating InstructionsFeatures:Designed and tested by synthetic chemists.Controller provides repeatable milliamp selection for photon intensity (sold seperately)527 nm wavelength0-30 mA variable LED outputNon-magnetic LED baseChemically resistant LED coverPTFE coated cablingPhoto Kitalysis Starter Kitrequired for operation (sold separately). Best when used withKitAlysis Benchtop Inertion Box(sold separately)... Read More | This reagent kit is specially developed for one-step RT-PCR experiments. Reverse transcription and PCR are carried out in the same reaction system, without the need to add reagents or open the tube cap during the reaction process, which improves detection sensitivity and experimental efficiency This reagent kit is specially developed for one-step RT-PCR experiments. Reverse transcription and PCR are carried out in the same reaction system, without the need to add reagents or open the tube cap during the reaction process, which improves detection sensitivity and experimental efficiency while avoiding contamination. This kit includes a brand new high-efficiency reverse transcriptase, a fast hot start DNA polymerase, as well as reaction buffer suitable for reverse transcription and PCR amplification, and other components necessary for the experiment. The loss of activity of SuperRT reverse transcriptase RNase H reduces RNA degradation in reverse transcription reactions. This reverse enzyme has high reverse transcription efficiency and can perform good reverse transcription reactions on a small amount of RNA templates. The rapid hot start DNA polymerase used in PCR reaction has excellent performance of high amplification efficiency, strong specificity, and fast extension speed. The unique buffering system maximizes the efficiency of both reverse transcriptase and polymerase. The target product amplified using this reagent kit has an A base attached to the 3 'end, which can be directly used for T/A cloning.S665660Component100 TStorageS665660ASuperRT OneStep EnzymeMix50 µL-20℃. Avoid freeze/thaw cycle.S665660B2×SuperRT OneStep Buffer1.4 mL-20℃. Avoid freeze/thaw cycle.S665660CRNase-Free Water1.5 mL-20℃. Avoid freeze/thaw cycle. Notes:1. During the operation process, RNase contamination should be avoided to prevent RNA degradation or cross contamination during experiments. It is recommended to perform RNA operations in specialized areas, use specialized instruments and consumables, and have operators wear masks and disposable gloves, and frequently change gloves.2. Disposable plastic containers should be used as much as possible for experiments. If glass containers are used, they should be treated with a 0.1% DEPC (diethyl pyrocarbonate) aqueous solution at 37 ℃ for 12 hours, and sterilized under high pressure at 120 ℃ for 30 minutes before use. Alternatively, glass containers should be sterilized under dry heat at 180 ℃ for 60 minutes before use. The sterile water used in the experiment should be treated with 0.1% DEPC and then subjected to high-pressure sterilization.3. All reagents in this reagent kit should be gently mixed upside down before use, avoiding foaming as much as possible, and used after brief centrifugation. The enzymes involved should be returned to -20 ℃ as soon as possible after use to avoid repeated freeze-thaw cycles.4. This reagent kit must use specific primers, and the selection of primers can be based on specific experiments. The quality of primer design directly affects the results of RT-PCR reactions. When designing primers, factors such as GC content, primer length, primer position, and the secondary structure of PCR products need to be considered. It is recommended to use professional primer design software.Usage:1. Dissolve the RNA template, primers, OneStep RT-PCR Buffer, SuperRT OneStep RT-PCR EnzymeMix, and RNase Free Water and place them on ice for later use.2. Prepare the reaction system according to the following table: Reagent 25 µlReaction system Final concentration 2×SuperRT OneStep Buffer 12.5 µl 1× Forward Primer,10 µM 1 µl 0.4 µM Reverse Primer,10 µM 1 µl 0.4 µM SuperRT OneStep EnzymeMix 0.5 µl / RNA Template X µl 1 pg – 1 µg RNase-Free Water up to 25 µl / Attention: The primer concentration should be between 0.1 and 1.0 as the final concentration µ M serves as a reference for setting the range. In the case of low amplification efficiency, the concentration of primers can be increased; When non-specific reactions occur, the primer concentration can be reduced to optimize the reaction system.3. Vortex and shake well, centrifuge briefly, and collect the solution to the bottom of the tube.4. Preheat the thermal cycler to 45 ℃, place the PCR tube in the thermal cycler, and perform RT-PCR reaction.Reaction conditions: Step Temperature Time / Reverse transcription 45℃ 30 min / PCR pre denaturation 95℃ 2 min Denaturation 94℃ 30 s 30-40 cycles Anneal 55-65℃ 30 s 30-40 cycles Extend 72℃ 30 s 30-40 cycles Finally extended 72℃ 5 min /Attention:1) In general PCR experiments, the annealing temperature is 5 ℃ lower than the melting temperature Tm of the amplification primer, and the annealing time is generally 20-30 seconds. If the ideal amplification efficiency cannot be achieved, the annealing temperature should be appropriately reduced; When non-specific reactions occur, increase the annealing temperature to optimize the reaction conditions.2) The extension time is set based on the size of the amplified fragments, and the DNA Polymerase amplification efficiency contained in this product is 1 kb/30s.3) The number of cycles can be set based on the downstream application of the amplification product. Too few cycles, insufficient amplification; Multiple cycles increase the probability of mismatches and result in severe non-specific backgrounds. Therefore, while ensuring product yield, the number of cycles should be minimized as much as possible.5. After the reaction is complete, take 5 µ l of the reaction product, add an appropriate amount of loading buffer, and perform electrophoresis detection results... Read More |