| Description | Inquire | DescriptionThe 1 µm Coupling Kit makes conducting immunoprecipitation and biomolecule separation easier and more flexible. The Kit contains AnteoBind™activated 1 µm magnetic particles that give you increased antibody binding capacity and functionality, while the included blocking DescriptionThe 1 µm Coupling Kit makes conducting immunoprecipitation and biomolecule separation easier and more flexible. The Kit contains AnteoBind™activated 1 µm magnetic particles that give you increased antibody binding capacity and functionality, while the included blocking buffer decreases background noise. Reduce reagent preparation time; remove traditional surface preparation steps such as EDC and replace these steps with the 1 µm pre-activated magnetic particles provided. This Kit reduces aggregation and gives you the freedom and ability to develop multifunctional particles for diverse applications, including dual labelling.Binding Capacity and Dispersity:Binding Capacity:> 20 µg IgG/mgMonodispersity:> 90% (by light microscopy determination)Particle based immunoassays, bioseparations and immunoprecipitation... Read More | The content of this cell is too long for an XLSX file (more than 32767 characters). Please use the CSV format for this export | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | S665948 Component 1 mL 5 mL Storage S665948A 2×SYBR qPCR Master Mix 1 mL 5×1 mL -20℃. Avoid freeze/ Thaw cycle. S665948B qPCR Primer Mix 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948C DNA Standard 1 100 µL 5×100 µL -20℃. Avoid S665948 Component 1 mL 5 mL Storage S665948A 2×SYBR qPCR Master Mix 1 mL 5×1 mL -20℃. Avoid freeze/ Thaw cycle. S665948B qPCR Primer Mix 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948C DNA Standard 1 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948D DNA Standard 2 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948E DNA Standard 3 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948F DNA Standard 4 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948G DNA Standard 5 100 µL 5×100 µL -20℃. Avoid freeze/ Thaw cycle. S665948H 50×High ROX 40 µL 200 µL -20℃. Avoid freeze/ Thaw cycle.Product IntroductionThis product is used for real-time fluorescence quantitative PCR (qPCR) using the product after NGS library construction by dye method (SYBR Green I). The kit provides the reaction mixture, DNA primer mixture, and standards required for the qPCR process, and the reagent system is complete, easy and convenient to operate. The kit uses a new chemically modified high-efficiency hot-start polymerase, the activation of the enzyme needs to be incubated at 95 ℃ for 10 min. the product is highly specific, high amplification efficiency, and able to quickly and accurately quantify the concentration of the constructed library. It is suitable for fluorescent quantitative PCR instruments that do not require ROX as a calibration dye, such as Roche LightCycler 480, Roche LightCyler 96, Bio-radiCyleriQ, iQ5, CFX96.ROX dye is used to correct the fluorescence signal error generated between wells of a quantitative PCR instrument, and is generally used in Real Time PCR amplifiers from ABI, Stratagene, and other companies. The excitation optics vary from instrument to instrument, so the concentration of ROX dye must be matched to the corresponding fluorescence quantitative PCR instrument.Instruments that do not require ROX calibration: Roche LightCycler 480, Roche LightCyler 96, Bio-rad iCyler iQ, iQ5, CFX96, etc.Instruments requiring Low ROX calibration: ABI Prism7500/7500 Fast, QuantStudio®3 System, QuantStudio®5 System, QuantStudio®6 Flex System, QuantStudio®7 Flex System, ViiA 7 System, Stratagene Mx3000/Mx3005P, Corbett Rotor Gene 3000, and others.Instruments requiring High ROX calibration: ABI Prism7000/7300/7700/7900, Eppendorf, ABI Step One/Step One Plus, etc.Note: High Rox and Low Rox are formulated as described in Use 2.Scope of applicationThis product is designed for absolute quantification of the concentration of Illumina platform second-generation sequencing libraries. The end of the library contains Illumin P5 and P7 chip binding sequences, the length of which does not exceed 1kb, and the concentration of which is not less than 0.002pM can be used to perform quantitative experiments with this product. The qPCR Primer Mix provided in the kit contains the following two primer sequences:Primer 1:5'-AAT GAT ACG GCG ACC ACC GA-3' Primer 2: 5'-CAA GCA GAA GAC GGC ATA CGA-3'The primer sequence can be used in advance to confirm whether the library can be amplified by that primer pair.UsageAmplification template preparationThe library samples to be detected were diluted with TE (10 mM Tris-Cl, pH 8.0, 1 mM EDTA), and the concentration after dilution was as close as possible to the range of 0.01-20 pM. 4°C on ice was set aside.qPCR reaction system preparationThe desired cryopreservation reagent is pre-melted completely and mixed by inverting several times before preparation, then centrifuged briefly and set aside.The base reaction system for 20 µl was as follows:Reagent20 µl Reaction system2×SYBR qPCR Master Mix10 µlqPCR Primer Mix 10.8 µlTemplate4 µlddH₂O5.2 µlDescription: High Rox model: add 1 µl High Rox per 50 µl of reaction system;Low Rox model: 1 µl High Rox per 500 µl of reaction system.Prepare a sufficient amount of reaction system mixture according to the need, mix well and add to the reaction wells in a volume of 16 µl per well, add the same volume of TE to the blank control, and then add the prepared standards and diluted samples to the corresponding reaction wells in a volume of 4 µl/well. It is recommended to use 20 µl reaction system, if you need to carry out a smaller system reaction, the system components can be reduced in equal proportion.qPCR reaction programThe annealing temperature should be 60-64°C as a reference for the setting range, and the annealing temperature can be increased when a non-specific reaction occurs.If the average length of the library is greater than 700bp, the annealing/extension time should be increased appropriately.data analysisStandard curve productionThe standard curve was plotted using Ct values in the valid range. The standard curve correlation coefficient R2 should not be less than 0.99 and the slope should lie between -3.1 and -3.6. If the standard curve parameters are not reasonable, it is recommended to repeat the experiment.DNA Standard NameDNA Standard ConcentrationDNA Standard 120 pMDNA Standard 22 pMDNA Standard 30.2 pMDNA Standard 40.02 pMDNA Standard 50.002 pMLibrary Concentration CalculationsThe difference in Ct between the three replicate wells of the experiment should be no more than 0.2, otherwise the invalid data should be deleted or the experiment should be repeated. Do not use the Ct outside the valid Ct range of the standard curve to calculate the concentration of the diluted libraries. Please refer to the data processing Excel of this product for the specific library concentration calculation method.matters needing attentionThese instructions should be read in detail before testing. It should be carried out by personnel with specialized experience or qualified by training.Mix gently by turning up and down, avoid foaming as much as possible, and centrifuge for a short time before use.Avoid repeated freezing and thawing of this product; repeated freezing and thawing may degrade product performance.When preparing reaction solutions, use new or non-contaminated tips and centrifuge tubes to prevent contamination as much as possible... Read More |