| Description | Starch hydrolases include α-amylase (α-AL, EC 3.2.1.1) and β-amylase (β-AL). α-Amylase randomly catalyzes the hydrolysis of α-1,4-glycosidic bonds in starch, producing reducing sugars such as glucose, maltose, maltotriose, and dextrins, while simultaneously Starch hydrolases include α-amylase (α-AL, EC 3.2.1.1) and β-amylase (β-AL). α-Amylase randomly catalyzes the hydrolysis of α-1,4-glycosidic bonds in starch, producing reducing sugars such as glucose, maltose, maltotriose, and dextrins, while simultaneously reducing the viscosity of starch, hence it is also known as the liquefying enzyme. α-Amylase is widely distributed, from microorganisms to higher plants. Detection Principle: Starch hydrolases catalyze the hydrolysis of starch to produce reducing sugars. These reducing sugars reduce 3,5-dinitrosalicylic acid (DNS) to produce a brown-red-colored compound with an absorption peak at 540 nm. The amylase activity is calculated by measuring the rate of increase in absorbance at 540 nm. α-Amylase is heat-stable, but β-amylase can be inactivated by heating at 70°C for 15 minutes. Therefore, after the crude enzyme extract is treated at 70°C for 15 minutes, only α-amylase can catalyze starch hydrolysis. Detection Range: 0.0156 - 1 mg/mL Sensitivity: 0.0078 mg/mL Applicable Samples: Saliva, animal tissues, plant tissues (seeds or newly germinated seedlings) Note: The detection range and sensitivity are based on the standard. The actual detection range and sensitivity for activity need to be calculated according to the sample conditions.G1501772Component96TStorageG1501772ADNS Reagent40 mL2-8℃. Store in the dark.G1501772BSubstrate1EA2-8℃G1501772CStandard1EA2-8℃Note: Before formal testing, it is recommended to perform a preliminary test with 2-3 samples expected to have significant differences.User-Prepared Instruments and Reagents1.Microplate reader or visible spectrophotometer (capable of measuring absorbance at 540 nm)2.96-well plate or micro glass cuvettes, adjustable micropipettes and tips3.Centrifuge, water bath4.Deionized water5.Homogenizer (for tissue samples)Experimental Procedure1. Reagent PreparationReagent NameReagent PreparationNotesDNS ReagentReady-to-use; Equilibrate to room temperature before use.Store at 4°C protected from light.SubstrateBefore use, add 20 mL deionized water, invert and shake several times, heat until dissolved.Unused reagent can be stored at 4°C for one week. If precipitate forms, heat to 70°C to dissolve.StandardBefore use, add 1 mL deionized water to dissolve, obtaining a 10 mg/mL standard (Glucose) stock.Can be stored at 4°C for 2 weeks.2. Standard Curve SetupDilute the 10 mg/mL standard stock solution with deionized water to concentrations of 1, 0.5, 0.25, 0.125, 0.0625, 0.0313, and 0.0156 mg/mL as shown in the table below.TubeStandard VolumeDeionized Water Volume (µL)Standard Concentration (mg/mL)Std.140µL (10 mg/mL)3601Std.2200µL of Std.12000.5Std.3200µL of Std.22000.25Std.4200µL of Std.32000.125Std.5200µL of Std.42000.0625Std.6200µL of Std.52000.0313Std.7200µL of Std.62000.0156Note: The standard curve must be generated with each experiment. Diluted standard solutions are unstable and must be used within 4 hours3. Sample PreparationNote: Fresh samples are recommended.3.1 Animal TissueWeigh approximately 0.1 g of tissue. Add 1 mL of deionized water and homogenize. Transfer the homogenate to a centrifuge tube. Let it stand at room temperature for 15 minutes, vortexing every 5 minutes for sufficient extraction. Centrifuge at 6,000 g for 10 minutes at room temperature. Aspirate the supernatant and dilute to 10 mL with deionized water. Mix well. This is the amylase stock solution.3.2 Plant TissueWeigh approximately 0.1 g of tissue. Add 1 mL of deionized water and grind. Sonicate for 5 minutes (power 20%, pulse 3s on, 7s off, repeat 30 times). Let it stand at room temperature for 15 minutes, vortexing every 5 minutes for sufficient extraction. Centrifuge at 6,000 g for 10 minutes at room temperature. Aspirate the supernatant and dilute to 10 mL with deionized water. Mix well. This is the amylase stock solution.3.3 Saliva, and Other Liquid SamplesAssay directly. It is recommended to perform a preliminary test to determine the appropriate dilution factor.Note:For animal tissues with high fat content, remove the upper fat layer after centrifugation before collecting the supernatant.If protein concentration measurement is required, use Aladdin's BCA Protein Quantification Kit (B665595) or Ready-to-Use BCA Protein Quantification Kit (R1491648).4. Assay Steps4.1 Preheat the microplate reader or visible spectrophotometer for at least 30 minutes. Set the wavelength to 540 nm. For spectrophotometers, zero the instrument with deionized water.4.2 Preheat a water bath to 70°C.4.3 Take 75 µL of sample and incubate in a boiling water bath for 5 minutes. This will be used as the Control tube.4.4 Sample Measurement (Add reagents sequentially into microcentrifuge tubes as below):ReagentBlank Tube (µL)Standard Tube (µL)Test Tube (µL)Control Tube (µL)Deionized Water75000Standard (various conc.)07500Sample007575 (boiled sample)Heat at 70°C for 15 min, then cool.Substrate00750Incubate in a constant temperature water bath at 40°C for 5 min.DNS Reagent150150150150Substrate75750754.5 Mix well. Incubate in a boiling water bath for 5 minutes. Cool. Transfer 200 µL to a 96-well plate or micro glass cuvette. Measure the absorbance at 540 nm. Calculate ΔA test = A test - A control ; ΔA standard = A standard - A blank. Note: Each sample requires a control tube. The blank tube only needs to be prepared once. It is recommended to perform a preliminary test with 2-3 samples expected to have significant differences before the formal experiment. If A test > 2, the enzyme activity is too high, and the sample must be diluted with deionized water to an appropriate concentration (multiply by the dilution factor in the calculation). If ΔA test < 0.005, re-extract the sample reducing the final volume of deionized water used for dilution.5. Calculation of Results 5.1 Standard Curve Plotting Plot the standard concentration (y-axis) against ΔA standard (x-axis) to generate the standard curve. Substitute ΔA test into the standard curve equation to calculate y (mg/mL). 5.2 α-Amylase Activity Calculation (1) Based on Sample Fresh Weight Calculation (1) Based on Sample Fresh Weight Calculation Unit Definition: One unit of enzyme activity is defined as the amount of enzyme that catalyzes the production of 1 mg of reducing sugar per minute per gram of tissue. Calculation Formula: α-Amylase Activity (U/g weight) = y × V sample ÷ (W × V sample ÷ V total ) ÷ T × n = 2 × y ÷ W × n (2) Based on Sample Protein Concentration (2) Based on Sample Protein Concentration Calculation Unit Definition: One unit of enzyme activity is defined as the amount of enzyme that produces 1 mg of reducing sugar per minute per milligram of tissue protein. Calculation Formula: α-Amylase Activity (U/mg prot) = y × V sample ÷ (Cpr × V sample ) ÷ T × n = 0.2 × y ÷ Cpr × n (3) Based on Liquid Sample Volume Calculation Unit Definition: One unit of enzyme activity is defined as the amount of enzyme that produces 1 mg of reducing sugar per minute per liter of liquid sample. Calculation Formula: α-Amylase Activity (U/L) = 1000 × y ÷ T × n = 200 × y × n Parameter Definitions: y: Concentration of reducing sugar calculated from the standard curve (mg/mL) V sample : Volume of sample added to the reaction system (0.075 mL) W: Sample weight (g) V total : Total volume of the sample extract (10 mL) T: Enzymatic reaction time (5 minutes) n: Sample dilution factor Cpr: Sample protein concentration (mg/mL) 1000: Conversion factor between liters and milliliters (1 L = 1000 mL)6. Representative ResultsTypical Standard Curve: y = 0.4948x - 0.0179, R² = 0.9982Precautions1. Biochemical reagents are generally irritating and potentially biologically toxic. For your safety and health, please use appropriate biosafety precautions throughout the experiment, including wearing lab coats, masks, gloves, and head covers. Perform experiments in a fume hood or biosafety cabinet.2. This product is for research use only. Not for use in clinical diagnosis... Read More | DescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences theDescriptionCholesteryl ester transfer protein (CETP) is present in normal human plasma and transfers neutral lipids from high density lipoproteins (HDL) to very low density lipoprotein (VLDL) and low density lipoprotein (LDL). CETP plays an important role in lipoprotein metabolism and influences the reverse cholesterol transport pathway.Preparation instructionsSuitable for high-throughput screening (HTS), mechanism of action (MOA) studies, and structure-activity relationship (SAR) work in CETP sources.PrincipleThe CETP RP Activity Assay uses a proprietary substrate that enables the detection of CETP-mediated neutral lipid mass transfer. The method is useful for measuring CETP activity in recombinant protein (RP) or purified CETP samples and has a high D... Read More | N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.N666055 Component 96 T Storage N666055A Adaptor for Illumina 480 µL -20℃. Avoid freeze/thaw cycle. N666055B i7 Index Primers D701-D712 12×20 µL -20℃. Avoid freeze/thaw cycle. N666055C i5 Index Primers D501–D508 8×30 µL -20℃. Avoid freeze/thaw cycle.Products IntroductionThe NGS Combinatorial Dual Index Primers Kit for Illumina (Set I) is an index primer kit for library construction on the Illumina high-throughput sequencing platform. This kit contains the Universal Junction DNA Adaptor for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers for use with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina. Library Prep Set for Illumina, 8 i5 Index Primers, and 12 i7 Index Primers can be used with the Fast DNA Library Prep Set for Illumina & MGI and the NGS Frag Fast DNA Library Prep Set for Illumina to build up to 96 different combinations of bipartite Index-tagged second generation sequencing libraries. The prepared libraries can be used for sequencing on NovaSeq, MiSeq, HiSeq 2000/2500/3000/4000, MiniSeq and NextSeq sequencing platforms. All the reagents provided in the kit have been subjected to stringent quality control and functional validation to maximize the stability and reproducibility of the library construction.Scope of applicationFor use with Illumina High-Throughput Sequencing Platform Double-Ended Index Labeled Library Construction. Recommended for use with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina. product componentsNote: The amount of individual library DNA Adapter for Illumina used depends on the amount of starting template input. i7 Index Primers and i5 Index Primers both use 2.5 µl.Sequence information DNA Adapter for Illumina 5´-/Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTCTTCCGATC*T-3´ (* denotes thiolation, Phos denotes phosphorylation) i5 Index Primers 5´-AATGATACGGCGACCACCGAGATCTACAC [i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´i7 Index Primers 5´-CAAGCAGAAGACGGCATACGAGAT [i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3´.* denotes thio) [i5] denotes an 8 bp i5 Index sequence and [i7] denotes an 8 bp i7 Index sequence.The Index name corresponding to each primer, the Index sequence contained in the primer, and the Index entered in the Sample Sheet during sequencing.Library building process and library structureThis kit is used in conjunction with Fast DNA Library Prep Set for Illumina & MGI and NGS Frag Fast DNA Library Prep Set for Illumina, and the library construction process is summarized below:The structure of the constructed library is as follows 5'- AATGATACGGCGACCACCGAGATCTACAC [i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCT [DNA insert] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [i7] ATCTCGTATGCCGTCTTCTGCTTG-3' i5: i5 index, 8 bases i7: i7 index, 8 bases DNA insert: inserted target sequencing sequence... Read More | Product content N665859Component50 TStorageN665859ABuffer DS30 mLRTN665859BBuffer GTL15 mLRTN665859CBuffer GL15 mLRTN665859DBuffer GW1 (concentrate)13 mLRTN665859EBuffer GW2 (concentrate)15 mLRTN665859FBuffer TE10 mLRTN665859GProteinase K2×1.25 mLRTN665859HRNase A (100 mg/mL)0.4 Product content N665859Component50 TStorageN665859ABuffer DS30 mLRTN665859BBuffer GTL15 mLRTN665859CBuffer GL15 mLRTN665859DBuffer GW1 (concentrate)13 mLRTN665859EBuffer GW2 (concentrate)15 mLRTN665859FBuffer TE10 mLRTN665859GProteinase K2×1.25 mLRTN665859HRNase A (100 mg/mL)0.4 mLRTN665859ISpin Columns DF With Collection Tubes50 EA2-8℃N665859JCentrifuge Tubes (L-1.5 mL)50 EART Product IntroductionThis kit is suitable for the effective purification of genomic DNA from formalin-fixed, paraffin-embedded tissues.The product uses specially optimized dewaxing agent and lysis solution to release DNA from formalin-fixed or tissue sectioned samples, which does not involve the organic reagent xylene and does not need to be operated overnight; the digested samples are incubated at higher temperatures to remove formalin cross-linking of the free DNA, which can effectively improve the yield and purity of DNA; the optimized buffer system allows the inhibitors in the lysis solution to be specifically bound to the adsorbent membrane, which can be effectively removed by a two-step rinsing step. The optimized buffer system enables the DNA in the lysate to specifically bind to the adsorbent membrane, and the inhibitor is effectively removed by a two-step rinsing step, and finally eluted with low-salt buffer or water to obtain high-purity DNA.Meanwhile, configured with a high-efficiency microsorbent column, the elution volume can be as low as 20 µL.The purified DNA can be directly used for PCR, Real-time PCR, SNP Genotyping, STR genotyping, second-generation sequencing and pharmacogenomics research.The molecular weight of DNA isolated from formalin-fixed, paraffin-embedded samples is usually lower than that of DNA from fresh or frozen samples.The degree of DNA fragmentation depends on the type of sample, the duration of storage, and the conditions of fixation.Self-contained reagent: anhydrous ethanolPre-experiment Preparation and Important Notes1. After obtaining the sample, fix the sample in 4%-10% formalin as soon as possible, the fixation time should be 14-24 hours, too long a period of time will easily lead to genome breakage, affecting the downstream experiments. If the formaldehyde fixation time is too long or the sample has been stored for too long (> 1 year), it will easily lead to DNA integrity damage and unable to amplify long fragments.2. Ensure that the sample is thoroughly dehydrated before embedding; residual formalin will inhibit Proteinase K.3. Anhydrous ethanol should be added to Buffer GW1 and Buffer GW2 according to the instructions on the label of the reagent bottle before first use.4. Before use, please check Buffer GTL, Buffer GL and Buffer DS for any crystallization or precipitation. If there is any crystallization or precipitation, please re-dissolve Buffer GTL, Buffer GL and Buffer DS at 56℃ in a water bath.5. Preheat the water bath or thermostatic mixer to 56°C and keep the centrifuge at 25°C before starting the experiment.6. If downstream experiments are needed to reduce the low frequency of C>T:G>A transitions (artificial mutations) that occur to minimize the risk of false positives, 7 µL of UNG (1 U/uL) can be added after 1 hour of incubation at 90°C.Operation steps1. Sample processing:1a. Paraffin-embedded samples: Trim off excess paraffin from the tissue block with a scalpel to expose the tissue and then cut into 5-10µm slices. Take about 1×1cm2 slices (about 4-5 slices in total) and place them in a centrifuge tube (provided), add 160µL Buffer DS, vortex and shake for 10 seconds, then add 180µL Buffer GTL and 20µL Proteinase K, vortex and shake for 10 seconds. centrifuge the samples at 12,000rpm for 1 minute at 25℃.Note: 1) If the surface of the sample has been exposed to air, discard the 2-3 pieces that have been exposed to air and do not use them.2) DS will solidify below 18°C, and if it does it does not affect the following experiments.1b. Sample in formalin and other fixative: take about 20mg of sample, cut it into small pieces, place it in a centrifuge tube, add 500µL of 10mM PBS (PH7.4), vortex shaking, centrifuge at 12,000rpm for 1minute, discard the supernatant, and repeat 3 times. Add 180 µL Buffer GTL, 20 µL Proteinase K, vortex shaking to mix.2.56°C for 1 hour until the sample is completely dissolved. incubate at 90°C for 1 hour. centrifuge at 12,000 rpm, 25°C for 1 minute, and carefully pipette the lower aqueous phase (~180 µL) along the wall of the tube into a new centrifuge tube, trying to avoid aspirating the bottom precipitate and the upper layer of the wax solution.Note: 1) Samples can be left at room temperature after incubation at 56°C until the temperature of the water or dry bath reaches 90°C before placing the samples at 90°CIncubation.2) Optional step: add 7µL UNG (1U/µL), 50°C, 5min, no shaking. The purpose of this step is to minimize the risk of false positives by reducing the low-frequency occurrence of C>T:G>A transitions (artificial mutations) while effectively retaining the true occurrence of mutations.3. Optional step: If you need to remove RNA, you can lower the temperature of the sample to room temperature, then add 2µL of RNase A solution at a concentration of 100mg/mL, shake and mix well, and leave it at room temperature for 2 minutes.4. Add 20µL Proteinase K and incubate at 65℃, 450rpm for 15min.5. Add 200 µL of Buffer GL, mix well by vortexing and shaking, then add 200 µL of anhydrous ethanol and mix thoroughly by vortexing and shaking. Centrifuge briefly so that the solution on the wall of the tube collects at the bottom of the tube.Note: 1) Mix well immediately after adding Buffer GL and anhydrous ethanol.2) The addition of Buffer GL and anhydrous ethanol may produce a white precipitate that will not affect subsequent experiments.3) If more than one sample needs to be manipulated, the Buffer GL and anhydrous ethanol can be pre-mixed and spiked.6. Add all the solution obtained in step 5 to the adsorption columns (Spin Columns DF) that have been loaded into the collection tube, centrifuge at 25℃, 12000rpm for 2 minutes, pour out the waste liquid in the collection tube, and put the adsorption columns back into the collection tube.7. Add 500µL of Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12,000rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.8. Add 500µL of Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12000rpm for 1 minute, pour off the waste liquid in the collection tube, and put the adsorption column back into the collection tube.Note: Step 8 can be repeated if further DNA purity is required.9.12 Centrifuge at 2000 rpm for 2 minutes and pour off the waste liquid in the collection tube. Leave the adsorption column at room temperature for several minutes to dry thoroughly.Note: The purpose of this step is to remove residual ethanol from the adsorption column; ethanol residue can interfere with subsequent enzymatic reactions.10. Place the adsorption column in a new 1.5 mL collection tube, add 20-100 µL of Buffer TE or sterilized water to the middle of the adsorption column overhanging the column, let it stand at room temperature for 2-5 minutes, centrifuge it at 12,000 rpm for 1 minute, and collect the DNA solution.-20°C to preserve DNA.Note: 1) The pH value of the eluent has a great influence on the elution efficiency, if water is used as the eluent should ensure that its pH value is 7.0-8.5, the pH value is lower than 7.0 when the elution efficiency is not high.2) If the final concentration of DNA is to be increased, the DNA eluate obtained in step 10 can be re-spiked onto the adsorbent membrane and left at room temperature for 2 minutes and centrifuged at 12,000 rpm for 1 minute... Read More | Component Description T665563Component50 TStorageApplicationT665563AVNTR3820 1 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563BVNTR41201 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563CVNTR32321 mL-20℃. Avoid freeze/thaw Component Description T665563Component50 TStorageApplicationT665563AVNTR3820 1 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563BVNTR41201 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563CVNTR32321 mL-20℃. Avoid freeze/thaw cycle.High resolution 3-lite VNTR detectionT665563DMarkerⅠ300 µL-20℃. Avoid freeze/thaw cycle.DNA Molecular Weight Standard IT665563EMarkerⅡ250 µL-20℃. Avoid freeze/thaw cycle.DNA Molecular Weight Standard IIProduct IntroductionThis kit is a genotyping product for human Mycobacterium tuberculosis based on the latest research progress in molecular epidemiology1) and optimized by process. It utilizes variable-number tandem repeats (VNTR) polymorphisms in the Mycobacterium tuberculosis genome for genotyping to differentiate clinical strains, and is a powerful tool for studying the molecular epidemiology of Mycobacterium tuberculosis and monitoring the status of tuberculosis transmission. Compared with other existing Mycobacterium tuberculosis VNTR typing systems based on the VNTR principle, this typing system has a stronger ability to discriminate strains prevalent in China1,2,3), and is therefore particularly suitable for the needs of Chinese users.By carefully optimizing the primer sequences of each PCR reaction and the composition of the premixed reaction solution, this product has a strong anti-interference power. Compared with the user's own reagents, this product significantly improves the signal intensity of specific bands and reduces the appearance of non-specific bands when using crude templates (boiling bacterial solution), which makes the experimental operation easier and quicker, and at the same time, improves the success rate of the test. The premixed reaction solution is chemically stable and can effectively withstand repeated freezing and thawing (10 times) and a longer period of time (one week) at room temperature, which is better adapted to the user's need for flexibility in the detection work.This kit is a companion product to the TB Genotyping Kit VNTR-9. For samples identified as clustered or identical strains by the VNTR-9 kit, this product can be used for finer further typing identification if necessary. The three high-resolution detection sites VNTR3820, VNTR4120 and VNTR3232 in this product can be used in combination with the nine detection sites in the VNTR-9 to increase the resolution index (Hunter-Gaston index (HGI) to 0.9931).References1) Luo T et al. Development of a hierarchical variable-number tandem repeat typing scheme for Mycobacterium tuberculosis in China. PLoS One. 2014 Feb 25. 9(2)2)Sun G et al. Discriminatory potential of a novel set of Variable Number of Tandem Repeats for genotyping Mycobacterium marinum. Vet Microbiol. 2011 Aug Vet Microbiol. 2011 Aug 26;152(1-2)3) Zhang L et al. Highly polymorphic variable-number tandem repeats loci for differentiating Beijing genotype strains of Mycobacterium tuberculosis in Shanghai, China. FEMS Microbiol Lett. 2008 May;282(1):22-31.matters needing attention1.This product is a companion to the TB genotyping kit VNTR-9. The strains to be tested should be tested by VNTR-9 typing test first, and then use this product for testing. And the results of this product should be integrated and analyzed with the results of VNTR-9.2.To avoid contamination, it is recommended that the preparation of the organisms be done within a different location than the preparation of the PCR Mix and that different pipettes be used.3.Care should be taken at all stages of sample DNA collection, extraction and amplification to ensure proper labeling and to prevent cross-contamination between different samples.4.Commonly used reagents and consumables need to be autoclaved before experimentation.5.Each tube of PCR Mix contains different primers and cannot be mixed. It can be dispensed into different amounts at once according to the experimental needs to avoid repeated freezing and thawing.6.To avoid splashing the reaction solution when opening the reaction tube, centrifuge briefly before opening the cap and collect the liquid at the bottom of the tube. In case of accidental splashing on gloves or table, change gloves immediately and wipe the table with 75% alcohol or dilute acid.7.Be careful not to cross-contaminate the PCR Mix when aspirating, and it is recommended that the pipette tip be wiped with 75% alcohol 2 times before taking Mix each time.8.Pre-experiment preparation: 1×TE buffer (PH=8.0), 0.5×TBE buffer, agarose, ethidium bromide (EB), normal PCR instrument, DNA electrophoresis equipment and gel imager, 0.2 ml PCR reaction tubes, octuplex or 96-well PCR tubes, pipettes of different sizes: 0.5-10 µl and 20-200 µl.Operation steps1. DNA template preparation:1.1. scrape a small amount (1-2 inoculation loops) of sample from solid medium, resuspend in 100ul TE and inactivate at 80°C for 30 minutes.1.2. The inactivated strain was taken out of the P3 laboratory as follows:Boil at 100°C for 10 minutes (be careful to avoid bursting the cap of the EP tube during boiling to avoid letting water into the tube), place immediately on ice for 2 minutes, centrifuge at 12,000 rpm (~13,400 × g) for 10 minutes, take the supernatant and place in another sterile EP tube, label it, and store at -20°C.2. Testing procedures:2.1. Remove the TB Genotyping Kit HV-3, allow the liquid to equilibrate to room temperature, mix by shaking slightly 3-4 times, and then centrifuge at 12,000 rpm (~13,400 x g) for 5 seconds to allow the capped liquid to fall back into the tube.2.2.Three-locus VNTR typing: strains with identical results at 12 loci need to be further VNTR typed, i.e., the following four loci are added for comparison.1）PCR amplification: the reaction system was 20 µl. 19 µl of PCR Mix of VNTR3820, VNTR4120, and VNTR3232 were added to each PCR tube, 1 µl of DNA template was added, and mixed well.2）Amplification conditions:3) Gel preparation and electrophoresis:a: Notes:Important! Positive (H37Rv strain DNA) and negative controls (deionized water) need to be set up for each experiment.Key! This experiment is based on agarose gel electrophoresis to interpret the genotype of VNTR locus, therefore, in order to make the results accurate, it is necessary to follow the unified standard operation in this step of electrophoresis, and the following points should be noted:a-1: The comb used for glue making is 18 holes.a-2: The two wells on the left and right sides of the gel were discarded due to the tendency to distort the bands during electrophoresis, affecting the interpretation of the results, or a negative control was spotted in one of the wells. The remaining 16 wells were divided into 12 samples, 3 DNA Markers and 1 positive control. The order of spotting was "1, 2, M, 3, 4, 5, 6, M, 7, 8, 9, 10, M, 11, 12, H37Rv", the numbers represent samples, and M represents DNA Marker.a-3: When PCR amplification products are subjected to the first electrophoresis and Marker I is used, the gel concentration is 1%, the voltage is 150 V, and the time is 100-120 min.a-4: If the amplification product fragment is too large (>1000bp) and needs to be electrophoresed again and Marker II is used, the gel concentration is 0.8%, the voltage is 150V and the time is 150 minutes.b: Gluing as well as the electrophoresis process:PCR amplification products were electrophoresed using a 1% agarose gel.To prepare 1% agarose gel, 12×12 cm gel tray was used to make the gel, each gel was 80 ml.b-1: Weigh 0.8g of agarose, add 80ml of 0.5×TBE, weigh it on the balance and put it into the microwave oven, heat it on high for 2-3 minutes to make the agarose dissolve completely, shake it well, and observe it as a homogeneous and transparent solution without particles, then weigh it again on the balance and make up the appropriate amount of double-distilled water to keep the concentration of the gum unaffected.b-2: When the melted gel was cooled to about 55°C add 4 µl of ethidium bromide (10ug/ml) and gently swirl to mix well. The gel was made with an 18-tooth comb and the warm gel was poured into a 12 × 12 cm gel tray.b-3: Allow the gel to completely set (40 minutes at room temperature), carefully pull out the comb, remove the tray, and place it in the electrophoresis tank. Add 0.5× TBE buffer to the electrophoresis tank, not exceeding the gel surface by 1-2mm.b-4: Sample electrophoresis: add 12 samples to each gel (the topmost wells are not sampled), add 3-5µl PCR products to each well, and at the same time add three 5µl DNA MarkerⅠ to each gel. The voltage is 150V and the electrophoresis time is 100-120 minutes. This step is the key to the accuracy of the final readings of each point, and needs to be operated uniformly according to this standard.b-5: Some loci have amplification products greater than 1000bp in clinical strains, and these amplification products were then electrophoresed using 0.8% agarose gel, with DNA Marker II added as a control for the band size, voltage 150V, electrophoresis time 150 minutes.4) Results display:5) Analysis of results:a. If the genotypes of the three highly variable loci are also the same in different strains, they can be identified as clustered strains;b. If the high variant readings are highly similar, i.e., only 1-2 high variant sites are different, they need to be combined with epidemiologic data to identify if they are clustered strains;c. If all 3 high variant loci are genotypically discordant, identify as a single strain.Appendix 1: Rules for reading VNTR lociAppendix 2: VNTR locus repeat unit readout table... Read More |